ID: 922902531

View in Genome Browser
Species Human (GRCh38)
Location 1:229147926-229147948
Sequence GGTGCACACTTGCCCCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922902531_922902536 3 Left 922902531 1:229147926-229147948 CCGGCCTGGGGCAAGTGTGCACC No data
Right 922902536 1:229147952-229147974 GCCCCGCTGTTTCTTCCCCCAGG No data
922902531_922902538 4 Left 922902531 1:229147926-229147948 CCGGCCTGGGGCAAGTGTGCACC No data
Right 922902538 1:229147953-229147975 CCCCGCTGTTTCTTCCCCCAGGG No data
922902531_922902545 29 Left 922902531 1:229147926-229147948 CCGGCCTGGGGCAAGTGTGCACC No data
Right 922902545 1:229147978-229148000 ACTTCCAAGCCTGCGAATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922902531 Original CRISPR GGTGCACACTTGCCCCAGGC CGG (reversed) Intergenic
No off target data available for this crispr