ID: 922910680

View in Genome Browser
Species Human (GRCh38)
Location 1:229213657-229213679
Sequence CCAGAATCAAGCTTCCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922910680_922910683 0 Left 922910680 1:229213657-229213679 CCTTTGGGGAAGCTTGATTCTGG No data
Right 922910683 1:229213680-229213702 CTGTGGCCTGCAGTGAGCTGTGG No data
922910680_922910688 17 Left 922910680 1:229213657-229213679 CCTTTGGGGAAGCTTGATTCTGG No data
Right 922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG No data
922910680_922910684 1 Left 922910680 1:229213657-229213679 CCTTTGGGGAAGCTTGATTCTGG No data
Right 922910684 1:229213681-229213703 TGTGGCCTGCAGTGAGCTGTGGG No data
922910680_922910686 6 Left 922910680 1:229213657-229213679 CCTTTGGGGAAGCTTGATTCTGG No data
Right 922910686 1:229213686-229213708 CCTGCAGTGAGCTGTGGGCAAGG No data
922910680_922910687 9 Left 922910680 1:229213657-229213679 CCTTTGGGGAAGCTTGATTCTGG No data
Right 922910687 1:229213689-229213711 GCAGTGAGCTGTGGGCAAGGAGG No data
922910680_922910689 27 Left 922910680 1:229213657-229213679 CCTTTGGGGAAGCTTGATTCTGG No data
Right 922910689 1:229213707-229213729 GGAGGAAAGAAGGAATCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922910680 Original CRISPR CCAGAATCAAGCTTCCCCAA AGG (reversed) Intergenic
No off target data available for this crispr