ID: 922910688

View in Genome Browser
Species Human (GRCh38)
Location 1:229213697-229213719
Sequence CTGTGGGCAAGGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922910680_922910688 17 Left 922910680 1:229213657-229213679 CCTTTGGGGAAGCTTGATTCTGG No data
Right 922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG No data
922910679_922910688 18 Left 922910679 1:229213656-229213678 CCCTTTGGGGAAGCTTGATTCTG No data
Right 922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922910688 Original CRISPR CTGTGGGCAAGGAGGAAAGA AGG Intergenic
No off target data available for this crispr