ID: 922912396

View in Genome Browser
Species Human (GRCh38)
Location 1:229228592-229228614
Sequence CCCCTCAGTCTCCTGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922912396_922912403 7 Left 922912396 1:229228592-229228614 CCCAGCTTCAGGAGACTGAGGGG No data
Right 922912403 1:229228622-229228644 CACTTGAGACCAGGAGGTTGAGG 0: 16
1: 1642
2: 8545
3: 29914
4: 77604
922912396_922912402 1 Left 922912396 1:229228592-229228614 CCCAGCTTCAGGAGACTGAGGGG No data
Right 922912402 1:229228616-229228638 GAGAATCACTTGAGACCAGGAGG 0: 15
1: 1719
2: 32620
3: 85359
4: 147420
922912396_922912401 -2 Left 922912396 1:229228592-229228614 CCCAGCTTCAGGAGACTGAGGGG No data
Right 922912401 1:229228613-229228635 GGGGAGAATCACTTGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922912396 Original CRISPR CCCCTCAGTCTCCTGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr