ID: 922912767

View in Genome Browser
Species Human (GRCh38)
Location 1:229231498-229231520
Sequence ACGTCCTGGCCAAGATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922912767_922912772 3 Left 922912767 1:229231498-229231520 CCCTGGGATCTTGGCCAGGACGT No data
Right 922912772 1:229231524-229231546 CTAACTTGCTTCATGTACAATGG No data
922912767_922912773 4 Left 922912767 1:229231498-229231520 CCCTGGGATCTTGGCCAGGACGT No data
Right 922912773 1:229231525-229231547 TAACTTGCTTCATGTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922912767 Original CRISPR ACGTCCTGGCCAAGATCCCA GGG (reversed) Intergenic
No off target data available for this crispr