ID: 922912880

View in Genome Browser
Species Human (GRCh38)
Location 1:229232249-229232271
Sequence CTGGACAGCTTGGGGAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922912874_922912880 -6 Left 922912874 1:229232232-229232254 CCTCTTAGACTAAGCCACTGGAC No data
Right 922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG No data
922912872_922912880 -2 Left 922912872 1:229232228-229232250 CCGGCCTCTTAGACTAAGCCACT No data
Right 922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG No data
922912869_922912880 19 Left 922912869 1:229232207-229232229 CCTGCCTCTATCACAGGTAGACC No data
Right 922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG No data
922912871_922912880 15 Left 922912871 1:229232211-229232233 CCTCTATCACAGGTAGACCGGCC No data
Right 922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922912880 Original CRISPR CTGGACAGCTTGGGGAAAAT GGG Intergenic
No off target data available for this crispr