ID: 922916125

View in Genome Browser
Species Human (GRCh38)
Location 1:229259212-229259234
Sequence CTGTAGGAATTGTTGGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922916125_922916135 -8 Left 922916125 1:229259212-229259234 CCAATACCCAACAATTCCTACAG No data
Right 922916135 1:229259227-229259249 TCCTACAGAATGGGGGCAGGGGG No data
922916125_922916134 -9 Left 922916125 1:229259212-229259234 CCAATACCCAACAATTCCTACAG No data
Right 922916134 1:229259226-229259248 TTCCTACAGAATGGGGGCAGGGG No data
922916125_922916133 -10 Left 922916125 1:229259212-229259234 CCAATACCCAACAATTCCTACAG No data
Right 922916133 1:229259225-229259247 ATTCCTACAGAATGGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922916125 Original CRISPR CTGTAGGAATTGTTGGGTAT TGG (reversed) Intergenic
No off target data available for this crispr