ID: 922917579

View in Genome Browser
Species Human (GRCh38)
Location 1:229271176-229271198
Sequence TCCGGCTGGGCCGCAGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922917573_922917579 1 Left 922917573 1:229271152-229271174 CCCTGCGCCTGCGCGGAGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 208
922917574_922917579 0 Left 922917574 1:229271153-229271175 CCTGCGCCTGCGCGGAGCTGGAG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 208
922917570_922917579 20 Left 922917570 1:229271133-229271155 CCGGACGGAGGGTGGAGGGCCCT 0: 1
1: 0
2: 0
3: 11
4: 126
Right 922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 208
922917576_922917579 -6 Left 922917576 1:229271159-229271181 CCTGCGCGGAGCTGGAGTCCGGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922917579 Original CRISPR TCCGGCTGGGCCGCAGCCGC TGG Exonic
900180132 1:1307659-1307681 CCGGGCCGGGCCGCGGCCGCCGG - Intronic
900203864 1:1422834-1422856 ACCGGCTGGGCCGCATTCCCTGG + Intergenic
900211123 1:1456378-1456400 GCCTGCTGGGCCGCAGCCAAGGG - Intronic
900216949 1:1486697-1486719 GCCTGCTGGGCCGCAGCCAAGGG - Intronic
900224031 1:1524426-1524448 GCCTGCTGGGCCGCAGCCAAGGG - Intronic
900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG + Intergenic
908977708 1:69919452-69919474 TCCCGCTGGGCCGCTCCCACTGG - Intronic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
915519913 1:156436146-156436168 TCCGGCGGGTGCGCAGCGGCCGG + Intergenic
917739170 1:177946419-177946441 TCTTGCTGGGCAGCAGCCACAGG - Exonic
918423486 1:184386728-184386750 TCCGGCTGGCCGGCCGCTGCAGG + Intergenic
920340041 1:205269900-205269922 TCCGGCTGGGCTGCAGGAGGGGG - Intronic
922440739 1:225653276-225653298 TCCGGCGGGGGCCCGGCCGCCGG - Intergenic
922481181 1:225940931-225940953 TCCTGCTGCGGCGCAGCCACGGG - Exonic
922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG + Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1062957334 10:1548946-1548968 TCTGGCTGGGCCACAGGGGCGGG + Intronic
1063407612 10:5812771-5812793 TCCGCCTCGGCCGCTGCCCCGGG - Intronic
1064436421 10:15314863-15314885 TCGGCCTGGCCTGCAGCCGCGGG + Intronic
1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG + Intronic
1066126321 10:32346576-32346598 CCCCGCTGGGCCGCGGCGGCCGG + Intronic
1066180678 10:32958203-32958225 TCCCGCTGGGCCTCTCCCGCGGG + Intronic
1068669530 10:59709580-59709602 CCCGGCTGGCCCGGAGCTGCAGG - Exonic
1069019157 10:63466033-63466055 GCGGGCGGGGCAGCAGCCGCGGG + Intergenic
1071532353 10:86400197-86400219 TCCCGCAGGGCCGCAGCCGCGGG - Intergenic
1072281642 10:93871000-93871022 TCAGGCTGGGGTGCAGCTGCAGG - Intergenic
1075119135 10:119651592-119651614 TCTGGCCGGGCCGCCGCCGTGGG - Exonic
1076424883 10:130360876-130360898 TCCTGCTGGGCAGCAGCTGCGGG - Intergenic
1076916329 10:133424516-133424538 TCCCGCTCGGCCGCGGCCTCAGG - Exonic
1076936436 10:133569311-133569333 TCCCGCTCGGCCGCGGCCTCAGG - Intronic
1079451198 11:20601246-20601268 GGCGGCGGGGCGGCAGCCGCGGG - Exonic
1081702061 11:45158391-45158413 ACAGGCTGGGCCCCAGCAGCAGG + Intronic
1081811678 11:45917735-45917757 TCCAGCTGGGCCGTGGCGGCCGG + Exonic
1082238595 11:49850583-49850605 GCTGGCTGGGACCCAGCCGCAGG + Intergenic
1082658038 11:55874554-55874576 GCTGGCTGGGACCCAGCCGCAGG - Intergenic
1082880146 11:58029228-58029250 TCCGGCTGGTACGCTGCTGCTGG + Intronic
1083367265 11:62148753-62148775 TCTGGCTGAGCGGCAGCTGCAGG + Exonic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1084112557 11:67023413-67023435 TCCGGCTGGGCTCCAGCTGCCGG - Intronic
1084516773 11:69641849-69641871 CCCGGCTGCGCCTCAGCGGCCGG + Intronic
1085155050 11:74285904-74285926 TCCGGATGGGCTGGAGCAGCAGG + Exonic
1086697976 11:89865567-89865589 GCTGGCTGGGACCCAGCCGCAGG - Intergenic
1086708186 11:89978921-89978943 GCTGGCTGGGACCCAGCCGCAGG + Intergenic
1087672757 11:101127554-101127576 TCCGCCTCTGCCGCCGCCGCCGG - Exonic
1088481084 11:110296746-110296768 TCCCGCAGGCTCGCAGCCGCAGG + Intergenic
1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1096673306 12:53213145-53213167 GCTGGCTGGGCCGCCGGCGCCGG + Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100315534 12:93441649-93441671 TCCGGCTGCCCCGCCGCGGCCGG + Intronic
1103749771 12:123150840-123150862 GCCGGCCGGGCCGGGGCCGCGGG - Intergenic
1103925961 12:124423453-124423475 TCTGGCTGGGAAGCAGGCGCGGG - Intronic
1104127649 12:125862806-125862828 TCAGGCTGGAGAGCAGCCGCAGG - Intergenic
1106340281 13:28820390-28820412 TCCACCTGCGCCGCCGCCGCCGG + Exonic
1112509613 13:99997809-99997831 TGGGCCTGGGCCGCAGCCGTGGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1117368219 14:55051866-55051888 TCCCGCTTGGCCGCGCCCGCGGG - Intronic
1122029847 14:98904187-98904209 CCCGGATGGGCTGCAGCCGTGGG - Intergenic
1122218136 14:100217761-100217783 TCAGGCTGGGGCACAGCCTCTGG + Intergenic
1122812964 14:104297996-104298018 GCAGGCAGGGCCGCAGCCCCAGG + Intergenic
1123019235 14:105389845-105389867 TCCGGCAGGGCCGCGGCCCCAGG + Intronic
1123040236 14:105487390-105487412 TCAGGCTGGGGCGCCGCCCCAGG - Intronic
1124158766 15:27250868-27250890 TCCTCCTGGGCAGCACCCGCTGG + Intronic
1125175627 15:36818433-36818455 TCCCTCTGGGCCGGAGCCGACGG - Intergenic
1128429069 15:67573618-67573640 ACCTGCTGGGCCGCAGCCCCAGG + Intronic
1129852856 15:78804523-78804545 TCGGGCTGGGCAGCAGCAGAAGG - Intronic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132602376 16:779452-779474 GCCGGCTGGGACCCAGCCTCAGG - Intronic
1132724988 16:1334555-1334577 TCCTGCTGGGCGCCAGCGGCTGG + Exonic
1135113637 16:19708893-19708915 TCTGGGTGGGCAGCAGCCGTTGG - Intronic
1136022123 16:27446935-27446957 TCAGGCTGGGCTGCAGCAGGTGG - Intronic
1136711573 16:32241238-32241260 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136756342 16:32688167-32688189 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1136811770 16:33182207-33182229 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136818246 16:33292287-33292309 CCTGCCTGGGCCGCGGCCGCCGG + Intronic
1136824810 16:33348820-33348842 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136829876 16:33447591-33447613 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1140478792 16:75251637-75251659 GCCGGCTGGGCCGTGGCGGCAGG - Intronic
1141054507 16:80803674-80803696 CCCGGCTGGGCCGGGGGCGCGGG - Intronic
1142379078 16:89721594-89721616 TCGGGCCGGGCAGCACCCGCGGG + Exonic
1202990348 16_KI270728v1_random:5175-5197 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1203058481 16_KI270728v1_random:948521-948543 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1143011066 17:3866423-3866445 AGCGGCTGAGCCGCAGCCGGTGG + Intronic
1143174453 17:4948285-4948307 TCCGTCTGGGCCGCCGTCCCCGG - Exonic
1147612798 17:41811647-41811669 TCGGGCTTGGCCGCGGGCGCGGG + Exonic
1147989046 17:44322344-44322366 TCTGGCTGGGCAGCAGACCCAGG - Intronic
1147994583 17:44353889-44353911 GGGGGCGGGGCCGCAGCCGCGGG - Exonic
1148645503 17:49217798-49217820 TCTGGCCGGGGGGCAGCCGCTGG - Exonic
1148736900 17:49870036-49870058 GCTGGCTGGGCCGCAGGCTCAGG + Intergenic
1152099033 17:78290341-78290363 GCAGGCTGGGCGGCAGCGGCAGG + Intergenic
1152242560 17:79168001-79168023 CCCGGCTGGACCCCAGCCCCAGG + Intronic
1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1154300295 18:13186067-13186089 TCTGGCTGTGGAGCAGCCGCTGG + Intergenic
1155101282 18:22612835-22612857 TCAGGCTGGGCCCCAGCAGAGGG - Intergenic
1158213603 18:55076787-55076809 TTCGGCTTGGCTGCAGCCACAGG - Intergenic
1160414950 18:78703375-78703397 TCCGGCAGGTGAGCAGCCGCTGG - Intergenic
1160745520 19:709314-709336 TCGGGCTGGGCCGCGCCTGCCGG + Intronic
1160803467 19:980744-980766 TCGGGCTGGGCCGCAGCAGGAGG + Intergenic
1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG + Intronic
1161103184 19:2431505-2431527 TGCGGCTGGGGGGCAGCCTCTGG - Intronic
1161289010 19:3482989-3483011 TCAGGCTGGGGCGCAGCTCCCGG + Intergenic
1161425290 19:4199676-4199698 TGGGGCTGAGCCGCAGCTGCAGG - Exonic
1161447998 19:4328721-4328743 CCCCGCTGGGCCGCAGCAGCAGG + Exonic
1161802633 19:6424546-6424568 CCCGCCCGGGCCGCCGCCGCCGG + Exonic
1162008325 19:7794494-7794516 ACCGCCACGGCCGCAGCCGCAGG - Intergenic
1162113302 19:8413149-8413171 CCCCGCTGTGCCGCAGCTGCTGG - Intronic
1162718397 19:12647850-12647872 TACGGCGGGGCTGAAGCCGCGGG + Intronic
1163789967 19:19300890-19300912 TGAGGCTGGGCTGCAGCGGCTGG + Intronic
1164992080 19:32691974-32691996 TGCGGCCGGGCCCCAGCCGCTGG + Exonic
1166876826 19:45902568-45902590 ACCGGCTCCGCCGCAGCCGCCGG + Exonic
1167074985 19:47243220-47243242 TCGGCCCGCGCCGCAGCCGCGGG + Intergenic
925261414 2:2531661-2531683 TCTGGCTGGGCCACAGCCCTGGG - Intergenic
926151325 2:10427145-10427167 GCCGGCCGGGGCGCAGCCTCGGG - Exonic
927714333 2:25342241-25342263 CCCGGCGGGGCCGCAGAGGCCGG - Intronic
927751316 2:25673250-25673272 TCCTGCAGCGCCGCACCCGCAGG + Intronic
928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
929779042 2:44946096-44946118 TGCCCCTGGCCCGCAGCCGCGGG + Intergenic
936127546 2:109802407-109802429 TCCGGCTGGAGTGCAGCAGCTGG + Intronic
936217151 2:110569078-110569100 TCCGGCTGGAGTGCAGCAGCTGG - Intronic
936426291 2:112423662-112423684 TCCGGCTGGAGTGCAGCAGCTGG - Intronic
938291490 2:130153105-130153127 TCCGGATGGGCTGCAGCTCCGGG + Exonic
941816286 2:169799110-169799132 GCCGCGTGGGCCGCAGCCGGAGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
944154282 2:196593723-196593745 TCAGGCTCCGCCGCAGCCTCGGG - Intergenic
944413845 2:199464610-199464632 TCCGGCCGGGTCGCAGGGGCCGG + Intronic
946364987 2:219243519-219243541 TCAGGCTGAGCGGCAGCAGCAGG + Exonic
946421612 2:219568184-219568206 TGCGGCAGGGCAGCAGCCGCTGG + Exonic
947098357 2:226592076-226592098 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948630737 2:239301046-239301068 CCCGGCTGAGCAGCAGCAGCAGG - Intronic
1170999075 20:21396063-21396085 CCAGGCCGGTCCGCAGCCGCCGG - Exonic
1171135574 20:22691868-22691890 ACCGGCTCGGCCTCAGCCGGAGG + Intergenic
1171876894 20:30585662-30585684 CCTGGCTTGGCCGCAGCCACTGG - Intergenic
1178888531 21:36501027-36501049 TGCGGCTGAGCCGCACCCCCCGG - Intronic
1178914744 21:36699960-36699982 CCCGCCTGGGCCGGGGCCGCCGG - Intronic
1179951626 21:44711736-44711758 GCAGGTTGGGCTGCAGCCGCTGG + Intergenic
1180162002 21:46002287-46002309 TCGGGCTGGGCGGCAGCAGCTGG - Exonic
1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG + Intergenic
1184481893 22:44752791-44752813 TCCGGCCGGCGCGCAGCCTCCGG + Intronic
1184565003 22:45286541-45286563 TGGGGCTGGGCCACAGCAGCAGG - Intronic
1184651235 22:45920312-45920334 ACCGGTGGGGCCGCAGCTGCAGG + Intergenic
1185149288 22:49154759-49154781 TCCGGCTGGGACGGTGCCTCCGG - Intergenic
1185371227 22:50461798-50461820 TCTGGATGGGCGGCAGCCTCCGG + Exonic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950084639 3:10248687-10248709 TCTGGTTGGGCCGCAGGAGCAGG + Exonic
950522290 3:13504496-13504518 TCCGGATGGTCCGTGGCCGCCGG + Exonic
951217759 3:20040595-20040617 TCCCCCTGCGCCGCTGCCGCCGG + Exonic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
956640887 3:71414368-71414390 TCCACCTGGGCCTCAGCCTCTGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961446384 3:126983490-126983512 GACGCCTGGGCCGGAGCCGCAGG - Intergenic
961655261 3:128438360-128438382 TCAGGCTGGGCTGCAGCTGGGGG - Intergenic
966647205 3:182259799-182259821 GCCGGCTGGGCAGCAGCTGGTGG + Intergenic
967134699 3:186503560-186503582 ACCTGCTGGGCTGCAGCCCCAGG - Intergenic
968353501 3:198081315-198081337 CCTGGCTCGGCCGCAGCCACTGG + Intergenic
968583415 4:1405171-1405193 CCGGGCTGGGCCGCGGCCACCGG - Intronic
968897268 4:3411939-3411961 TCCGTGTGAGCCCCAGCCGCAGG + Intronic
969273090 4:6116151-6116173 TCAGGGTGGGCCCCAGCAGCCGG + Intronic
974047269 4:56908350-56908372 CCCGGCGGGGCCGCCGCCGCCGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983576847 4:169270354-169270376 ACCGGCCGGGCCGCAGCCCCAGG - Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
989983117 5:50666703-50666725 ACCGGCTGGGCGGCGGGCGCCGG - Intronic
990230967 5:53712578-53712600 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
992080630 5:73232550-73232572 TCCGTCTGGGCTGCAGCTGCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997302149 5:132813907-132813929 GACGGCTGGGCCGCTGCCCCCGG - Exonic
998152272 5:139764356-139764378 TCCGCCTGGGCTGCTGCAGCTGG + Intergenic
998850498 5:146346202-146346224 TCAGGCCGGGACGCAGCCGAAGG - Intergenic
999166186 5:149551311-149551333 TCCCTCTGGGCCGGAGCCGGCGG - Intronic
1002058984 5:176615230-176615252 CCAGGCCGGGCCGCAGCTGCTGG - Intergenic
1002140404 5:177134087-177134109 GCCGGCGGCGCTGCAGCCGCCGG + Intronic
1002600587 5:180352408-180352430 CCTGGCTGGGCCGCCTCCGCTGG - Intronic
1006719154 6:36138872-36138894 TCCAGCAGGTCCGCAGCTGCAGG - Exonic
1008511970 6:52284533-52284555 CCCGGCCGGGCCGCGTCCGCAGG + Intronic
1013648770 6:112172199-112172221 TCTGGCTGGTCAGCAGCTGCAGG - Intronic
1014246800 6:119078486-119078508 TCCCGCCGGCCCGAAGCCGCGGG + Exonic
1017672239 6:156778731-156778753 TCCGCCTCCGCCGCCGCCGCCGG + Exonic
1019492384 7:1321479-1321501 GCCTGCTGGGCCCCAGCCGTAGG + Intergenic
1019669809 7:2271364-2271386 TAAGGCTGTGCCGCAGCAGCTGG + Intronic
1020125429 7:5530421-5530443 GCCGTCTGGGCCGCAGCGGGGGG - Intronic
1023609778 7:41961048-41961070 TGTGGCTGGGCTGCAGCCCCTGG + Exonic
1025813442 7:64889456-64889478 TCCCGCGGGGACGCAGCCCCAGG - Intronic
1028567162 7:92246082-92246104 TCCGGCTCCGGCTCAGCCGCTGG - Exonic
1032391284 7:131556712-131556734 CCCGGCCCGGCCGCCGCCGCTGG - Intronic
1033641149 7:143264121-143264143 TGAGGCTGGGCCGCAACTGCAGG - Exonic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1036454233 8:8893509-8893531 CAGGGCTGGGGCGCAGCCGCGGG + Exonic
1037725140 8:21477143-21477165 GCAGGCTGCGCTGCAGCCGCTGG + Intergenic
1039598485 8:38812389-38812411 TACAGCTGGGCCGCCGCCGGGGG - Intronic
1042784925 8:72536797-72536819 CCCGGGTGCGCGGCAGCCGCGGG + Intergenic
1043929022 8:86069495-86069517 GCCGCCTGGGCCGCCGCCTCGGG + Exonic
1047499179 8:125429400-125429422 TCCGGGCGGGCGGCAGGCGCGGG + Intergenic
1048009343 8:130443553-130443575 GCCGGCTGGGCGGGAGGCGCGGG + Exonic
1049405437 8:142450077-142450099 GCCGGCGGGGCCGCTGCTGCTGG + Exonic
1049681754 8:143921893-143921915 TCCGGCTCTGCCTCTGCCGCGGG + Exonic
1049742709 8:144248742-144248764 TGCAGCCGGGCCCCAGCCGCTGG - Intronic
1052872635 9:33523643-33523665 CCTGGCTCGGCCGCAGCCACAGG - Intergenic
1053752325 9:41269210-41269232 CCTGGCTTGGCCGCAGCCACAGG + Intergenic
1053752775 9:41273467-41273489 CCTGGCTTGGCCGCAGCCACAGG + Intergenic
1053752860 9:41273801-41273823 CCTGGCTTGGCCGCAGCCACTGG + Intergenic
1054257852 9:62833542-62833564 CCTGGCTTGGCCGCAGCCACAGG + Intergenic
1054258383 9:62838150-62838172 CCTGGCTTGGCCGCAGCCACTGG + Intergenic
1054333471 9:63782222-63782244 CCTGGCTTGGCCGCAGCCACAGG - Intergenic
1054351502 9:64020937-64020959 CCTGGCTTGGCCGCAGCCACTGG - Intergenic
1055513807 9:77018423-77018445 CCCGGGTGGGGCGCAGCTGCGGG + Intergenic
1055611993 9:78032306-78032328 CCCGGCCGGACGGCAGCCGCAGG - Intergenic
1057684811 9:97222182-97222204 CCTGGCTTGGCCGCAGCCACAGG + Intergenic
1059416829 9:114167702-114167724 TCCAGCTGAGGCCCAGCCGCTGG - Exonic
1061006473 9:127930943-127930965 TCCGGCTGGGGCGGGGCCGCCGG + Intergenic
1061108546 9:128551254-128551276 GACAGCTGGGCCGCAGCCACTGG - Intergenic
1061479019 9:130887311-130887333 TCCGGCTGCGTCACAGCCGTCGG - Intronic
1062383585 9:136299312-136299334 TCTGGTTGGGCAGCAGCCACAGG - Intronic
1062491715 9:136808094-136808116 TCCGGGGGGGCCGGGGCCGCCGG + Exonic
1062514435 9:136925547-136925569 CTCGGCTGGGCCTCAGCCTCTGG + Intronic
1202800391 9_KI270719v1_random:170226-170248 CCTGGCTTGGCCGCAGCCACTGG - Intergenic
1202800473 9_KI270719v1_random:170556-170578 CCTGGCTTGGCCGCAGCCACAGG - Intergenic
1202800919 9_KI270719v1_random:174838-174860 CCTGGCTTGGCCGCAGCCACAGG - Intergenic
1186486406 X:9937377-9937399 GCCGGCTGAGCCCCAGCCCCTGG + Exonic
1196746200 X:119073412-119073434 GCAGGCTTGGCCGCAGCCCCCGG + Intergenic
1201153315 Y:11107200-11107222 CCTGGCTTGGCCGCAGCCACTGG - Intergenic