ID: 922918100

View in Genome Browser
Species Human (GRCh38)
Location 1:229275334-229275356
Sequence CCTTGCCTCTCTCTAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1064
Summary {0: 1, 1: 19, 2: 110, 3: 282, 4: 652}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922918100 Original CRISPR CCTTGCCTCTCTCTAGCTTC TGG (reversed) Intronic
900282015 1:1876059-1876081 CCTTTCTTCTTTCTGGCTTCTGG - Intronic
900414403 1:2528456-2528478 CCAGGCCTTTCACTAGCTTCCGG - Intergenic
900749276 1:4384202-4384224 CCATACCTCTCTCCTGCTTCTGG - Intergenic
900810185 1:4795978-4796000 CCAGGCCTCTCTCCTGCTTCTGG + Intergenic
900895895 1:5482603-5482625 CCCTGCCTCTCTATTGCTCCTGG - Intergenic
901429520 1:9204557-9204579 CCAGGCCTCTCTCCAGCTTCTGG + Intergenic
901727479 1:11253443-11253465 CCTTCCCTCTCCCTTGCTCCCGG + Intronic
902284634 1:15399269-15399291 CCTGGCCTCTCACTGGCTTTAGG - Intronic
902489854 1:16773343-16773365 CCTTGCCGCTTTCTGGCTTCTGG + Intronic
902830867 1:19011429-19011451 CCCAGCCTCTTTCTAGTTTCGGG + Intergenic
903122823 1:21227390-21227412 CCCAGCCTCCCTCTGGCTTCAGG - Intronic
903464186 1:23540620-23540642 CCTTGTCTCTCTCTAGTTCAAGG + Intergenic
903473657 1:23604956-23604978 CCTTGCCCCTTCCTAGCTTCTGG - Intronic
903807687 1:26017183-26017205 CCTTCCCTCCCTCCCGCTTCAGG - Intergenic
904173896 1:28611648-28611670 TCTTGCCTCCTTCTAGCCTCTGG - Intronic
904727580 1:32561437-32561459 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
904842734 1:33383873-33383895 CCTCGCCTCTTCCTAGCTTCTGG - Intronic
904892079 1:33787154-33787176 CCCTGCTTCTCCCTAGCTTCTGG - Intronic
904911836 1:33940104-33940126 CCTTTTCTCTTCCTAGCTTCTGG + Intronic
905253096 1:36662367-36662389 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
905995150 1:42375151-42375173 CCTTTCCTCTCTCTAGAGGCTGG + Intergenic
906365019 1:45201166-45201188 TGTTGCCTCTTGCTAGCTTCTGG - Intronic
906385405 1:45364419-45364441 TCTTGCCTTTTCCTAGCTTCTGG - Intronic
906617160 1:47241306-47241328 CCTTGGCTCTCTCTGCCTTGAGG - Intergenic
907492421 1:54816603-54816625 CCTTGCCTCTTTGTAGCTTCTGG + Intronic
907557766 1:55359481-55359503 CTTTGCCCCTTCCTAGCTTCTGG - Intergenic
907800220 1:57757456-57757478 CCCTTCCTCCTTCTAGCTTCTGG + Intronic
908382920 1:63613441-63613463 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
908769962 1:67586985-67587007 CCATTTCTCTCTCTAACTTCAGG + Intergenic
908893188 1:68868947-68868969 TCTTGTCTCTCTCTCTCTTCAGG - Intergenic
909248244 1:73317967-73317989 CCTTGCCTCTTGTTAGCTTCTGG + Intergenic
909248395 1:73320405-73320427 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
909453327 1:75823081-75823103 CTTTGCCCCTTTCTAGCTTTTGG + Intronic
909456482 1:75855492-75855514 TCTTGCCTCTTCCTAGCTTTTGG + Intronic
909461256 1:75917072-75917094 CCTTACCTCATTCTAGCTTCTGG - Intergenic
909671658 1:78195982-78196004 CTTTGCCTCATCCTAGCTTCTGG + Intergenic
909697251 1:78481667-78481689 CCATGCCTTTGCCTAGCTTCTGG - Intronic
909805876 1:79873715-79873737 TCTTGTCTGTCTCTTGCTTCTGG + Intergenic
909942231 1:81624081-81624103 CCCTGCCTCTTCTTAGCTTCTGG - Intronic
910959615 1:92747841-92747863 CCTTGCCTCTTCCTAGCTTTGGG + Intronic
911319313 1:96393396-96393418 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
911538578 1:99130440-99130462 CCCTGCCTCTGTGTTGCTTCTGG + Intergenic
911876675 1:103173578-103173600 CCTTGCCTCACTCTTGGTTTTGG - Intergenic
912259509 1:108096421-108096443 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
912510828 1:110189163-110189185 GCTTGTCTCTCTCTGGCTCCAGG + Intronic
912518102 1:110228400-110228422 CCTTGACTCTCCCTGGCCTCAGG - Intronic
912748350 1:112264809-112264831 TGTTTCCTCTCTCTAGCTTCTGG - Intergenic
913113109 1:115673472-115673494 CCTTGCCTCTTCCTAGTTTCTGG + Intronic
913176240 1:116275681-116275703 CCTTGCCTCTCACTAGCTTCTGG + Intergenic
913434232 1:118830488-118830510 GTTTGCCTCTTTCTAGGTTCAGG - Intergenic
913441959 1:118907696-118907718 TCTTGCTCCTCTTTAGCTTCAGG + Intronic
913664091 1:121031607-121031629 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
913715187 1:121526607-121526629 CCTTGCCTCTGCCTAGCATCTGG - Intergenic
914015484 1:143814886-143814908 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
914162300 1:145146122-145146144 CCTTGCCTCTTCCTAGTTTCTGG + Intergenic
914229952 1:145756687-145756709 CCATGATTCTCTCTGGCTTCTGG + Intronic
914654101 1:149723427-149723449 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
915650133 1:157303645-157303667 CCTTGCCCCTTCTTAGCTTCTGG - Intergenic
915661385 1:157408528-157408550 CCTTGCCCCTTCTTAGCTTCTGG + Intergenic
916303879 1:163306833-163306855 TCATGCCTCTCCCTGGCTTCTGG - Intronic
916371612 1:164102311-164102333 TATTGCCTCTCTCTAGATACAGG + Intergenic
916723472 1:167502842-167502864 CCAAGCCTCTCCCCAGCTTCTGG - Intronic
916745858 1:167684362-167684384 CCTTGCCTTGCTCTGGCTACAGG - Intronic
916767244 1:167873232-167873254 TATTCCTTCTCTCTAGCTTCAGG + Intronic
916963673 1:169913530-169913552 CCTTGCTTCTTCCTGGCTTCTGG - Intergenic
917005971 1:170417738-170417760 CCATGCCTCTCCGCAGCTTCTGG - Intergenic
917505400 1:175622804-175622826 TCTTGCCTCTTCCTAGCTCCTGG + Intronic
917522914 1:175762918-175762940 CCTTGCCTCTGCCTGGCTCCTGG - Intergenic
918014241 1:180617590-180617612 CCTTGCCTCTTCCTAGCATCTGG + Intergenic
918157462 1:181863176-181863198 TCTTGCCTCTCCCCAGCTGCTGG - Intergenic
918290418 1:183102112-183102134 CTTTGTCTCTCTCTGGCTGCCGG - Intronic
918587985 1:186209751-186209773 CCCTGCCTTTTCCTAGCTTCTGG - Intergenic
918954576 1:191189073-191189095 TCATGCCTCTCTCTAGTTTCTGG + Intergenic
919727414 1:200893416-200893438 CCTTGCCCATCTCCAGCTCCAGG - Intronic
920111794 1:203592239-203592261 CCTGGCCTCTCTCTCCCTGCCGG + Intergenic
920235046 1:204497256-204497278 CCCTCCCTCTCTCTTGATTCAGG + Intergenic
920833627 1:209487644-209487666 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
920839607 1:209543257-209543279 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
920944006 1:210511547-210511569 CCCTGCCTGTCCCTAGCTTCCGG - Intronic
921109877 1:212025318-212025340 AGTTCCCTCTCTCTAGCTCCTGG - Intronic
921122479 1:212148921-212148943 CCTTGCCTTGTCCTAGCTTCTGG - Intergenic
921868055 1:220107795-220107817 ACTTGCCTCTTTCTAGCTTTTGG + Intronic
922055916 1:222042458-222042480 CCGTGTCTCTCTCTAGTTCCTGG + Intergenic
922323616 1:224509316-224509338 CCTTTCGTCTTTCTATCTTCAGG - Intronic
922352221 1:224743713-224743735 CCTTTCCCCTCTCCATCTTCAGG + Intergenic
922707499 1:227796976-227796998 CCTTGGCTCTGTCGAGCATCCGG + Intergenic
922775239 1:228211502-228211524 CCTTCCCTCTCCCTACCTACAGG - Intronic
922918100 1:229275334-229275356 CCTTGCCTCTCTCTAGCTTCTGG - Intronic
922993268 1:229934143-229934165 CCTTGCCTTTTTCTGTCTTCTGG + Intergenic
923145854 1:231197130-231197152 CCTTACCTCTATCCAGCTTTGGG + Intronic
923530586 1:234809185-234809207 CCTTGCCGCTTTCTGGCTTCTGG - Intergenic
923564667 1:235067937-235067959 CCTTTCCTCTCCCCAGCTTTTGG - Intergenic
924553346 1:245098431-245098453 CCTTCCCTATCTCTAACTTTGGG - Intronic
924744846 1:246822367-246822389 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1063003657 10:1947737-1947759 CCTTGCCTCTCCCAAGCTTCTGG + Intergenic
1063305241 10:4892684-4892706 CCTTGCCTTTGACTAGCTTTTGG - Intergenic
1063551925 10:7041737-7041759 CCTGTCCTCTGTCCAGCTTCAGG + Intergenic
1063834947 10:10002046-10002068 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
1064320035 10:14296413-14296435 CCTTGCCTCTCTCAAGCCTCTGG + Intronic
1064504991 10:16019041-16019063 CCTTGCCTTACTCCATCTTCAGG - Intergenic
1064703663 10:18048129-18048151 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1065581303 10:27174602-27174624 CTTTGCCTCTTCCTGGCTTCTGG + Intronic
1066459805 10:35603281-35603303 CCTTACCTCCAGCTAGCTTCAGG + Intergenic
1066665955 10:37782774-37782796 TCTTGCCTCTTCCTAGCTTCTGG - Intronic
1067179752 10:43975799-43975821 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1067396623 10:45925805-45925827 CCTGGCCTCTTCCTAGCTTCTGG + Intergenic
1067864938 10:49894908-49894930 CCTGGTCTCTTCCTAGCTTCTGG + Intronic
1067974477 10:51008477-51008499 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1068514434 10:58008550-58008572 CCTTACCCCTTCCTAGCTTCTGG - Intergenic
1068529876 10:58173718-58173740 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1068566593 10:58582717-58582739 CCTTGTCTTTCTCCAGCTTTTGG + Intronic
1068807305 10:61212095-61212117 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1069296358 10:66849682-66849704 CCTTGACCCTCCCTAGCTTCTGG - Intronic
1069867490 10:71512699-71512721 CTTTTCCTCTCTCCTGCTTCAGG + Intronic
1070236444 10:74632481-74632503 CCTTGTCTCTTCCTAGCTACTGG + Intronic
1070478804 10:76858825-76858847 TCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1070688419 10:78507098-78507120 CCTTCCCTCTCTCCTGCCTCAGG + Intergenic
1070703695 10:78621903-78621925 CCCTGCCCCTCTCTACCTCCAGG - Intergenic
1071189444 10:83082531-83082553 CCTTGCCTTTCCCTGGTTTCTGG + Intergenic
1071283406 10:84123616-84123638 CCTTTCCTCTCTCTTAGTTCTGG + Intergenic
1071815457 10:89227831-89227853 CCTTTCCTCCCTCTTCCTTCTGG - Intronic
1071878192 10:89865519-89865541 CCCTGCTTCTCACTATCTTCTGG - Intergenic
1071969699 10:90891216-90891238 CCTTGCCTCTTTTTAGCTTTTGG + Intronic
1072294452 10:93995444-93995466 CCTTTCTGCTCTCTACCTTCTGG + Intronic
1072396356 10:95046775-95046797 ACTTGACTCTCTCATGCTTCAGG + Intronic
1072594695 10:96860447-96860469 CCTTGTTTCTTCCTAGCTTCCGG - Intronic
1072601701 10:96937251-96937273 CCTTGCCTCTTCCTAGTTTCTGG - Intronic
1073620078 10:105037478-105037500 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
1073665863 10:105533137-105533159 CCTAGCCTCTTCCTAGCTGCAGG - Intergenic
1073673098 10:105614403-105614425 TCTTGACTCTTCCTAGCTTCTGG - Intergenic
1074610304 10:115015238-115015260 TCCTTCCTCTTTCTAGCTTCTGG + Intergenic
1074670635 10:115786427-115786449 CATTGCCTCTTTCTACGTTCGGG + Intronic
1074726875 10:116319907-116319929 CCTTGCCTCTCCCCAGCTTCTGG - Intergenic
1074765765 10:116698977-116698999 CCTTCTCTCCCTCTAGCTCCTGG + Intronic
1075127001 10:119708443-119708465 CCTTGCCTCTTCCCAGTTTCTGG - Intergenic
1075148927 10:119908627-119908649 CCTTCCCTCTTCCTAGCTTCTGG - Intronic
1075256954 10:120932940-120932962 CCTTGCCTCTTCTTAGCCTCTGG - Intergenic
1076065519 10:127444845-127444867 CCGGGCCTCCCTCCAGCTTCTGG + Intronic
1076508345 10:130993764-130993786 CCTTGCCTCCCCCCAGCTTCTGG + Intergenic
1077640211 11:3874522-3874544 CCAGGTCTCTCCCTAGCTTCAGG + Intronic
1078391637 11:10940138-10940160 CCTGGCCTCTTCTTAGCTTCCGG - Intergenic
1078433185 11:11303174-11303196 CCTTGCCTGTACCTAGCTCCAGG + Intronic
1078478699 11:11657327-11657349 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1078522687 11:12075967-12075989 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1078537194 11:12184774-12184796 CAATGCCCCTGTCTAGCTTCAGG + Intronic
1078862059 11:15257768-15257790 CCAGGCCTCTCTCTAGCTTCTGG - Intergenic
1078972874 11:16435532-16435554 TTTTGCCTCTTCCTAGCTTCTGG - Intronic
1079328422 11:19513902-19513924 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1079353540 11:19712962-19712984 CCTTGCCTCTATCTAGCTCACGG + Intronic
1079669481 11:23149423-23149445 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1081452145 11:43181549-43181571 CCTTGCCTTTTTCTAGCTACTGG - Intergenic
1081501327 11:43669615-43669637 CCTTGCCTCTTCCTAACTTCTGG + Intronic
1081562504 11:44230675-44230697 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1081635424 11:44718377-44718399 CCTTGCCTCTTGCTGGCTTCTGG + Intergenic
1081638303 11:44735456-44735478 CTTTGCCTCTTCCTAGCTTCTGG + Intronic
1082930955 11:58604370-58604392 CCTTGCCTCTTCCTAGCTTTTGG - Intronic
1083407204 11:62465822-62465844 CTTTGCCTCTTTCTAGCTGCTGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1083859946 11:65414860-65414882 CCTTGCCTGCTCCTAGCTTCTGG + Intergenic
1084434039 11:69127596-69127618 GCTGACCTCTCTCTAGCTGCTGG + Intergenic
1084450249 11:69232591-69232613 CCAGGCCTCTCTCCAGCTTCTGG - Intergenic
1085384162 11:76147184-76147206 CCTGTCCTCTCCTTAGCTTCAGG - Intergenic
1085404461 11:76253770-76253792 CCTTGTATCTTTCTAGCTTCTGG + Intergenic
1085676102 11:78520259-78520281 CCTTGCCTCTTCCTAGTTTCTGG + Intronic
1085683164 11:78597023-78597045 GCTTGGCTCTTCCTAGCTTCTGG + Intergenic
1085880024 11:80455567-80455589 CCTTGTCTCTTTCTAGTTTCTGG + Intergenic
1086172539 11:83852051-83852073 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1086756462 11:90569665-90569687 CCTTGCTTTTTTCCAGCTTCTGG - Intergenic
1086903986 11:92398083-92398105 CCTTGTCTCTTGCTAGCTTCTGG + Intronic
1087100298 11:94357271-94357293 CCTGGGGTCTCTCTAGCTTTTGG + Intergenic
1087191279 11:95257208-95257230 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1087614745 11:100474953-100474975 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1087755383 11:102049217-102049239 CCTTGCCTCTTCCTGCCTTCTGG + Intronic
1087986495 11:104688181-104688203 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1088019317 11:105100398-105100420 ACTTCCTTCTCTCTGGCTTCAGG - Intronic
1088073625 11:105820052-105820074 CCCTGCCTCTTCCTAGTTTCTGG - Intronic
1088358601 11:108968482-108968504 CTTTGCCTCTTGCTGGCTTCTGG - Intergenic
1088424311 11:109685448-109685470 TCTTGCTTCTCCCTAGCTTCTGG - Intergenic
1088605981 11:111532564-111532586 CTTTGCTTCTTTCTAGTTTCTGG - Intronic
1088770243 11:113028030-113028052 CCTTTCCCCTCTCCAGCCTCTGG - Intronic
1089156203 11:116404695-116404717 CCTTGCCTGTTTCTAGCTGTAGG - Intergenic
1090286038 11:125500208-125500230 TCTTGCCTCATTCTAGCTTTGGG - Intergenic
1090821899 11:130350096-130350118 TGTTGCCACTCTCTTGCTTCAGG + Intergenic
1091276655 11:134357403-134357425 CCTTGCCCCTTTCCAGCTTGAGG - Intronic
1091325887 11:134687264-134687286 CTGTGCCTCTCTGCAGCTTCTGG - Intergenic
1091769862 12:3144504-3144526 CCTGGCCTCTTTCTAGCTTCTGG - Intronic
1092878129 12:12866219-12866241 CCTTGCGTCTTCCTGGCTTCTGG - Intergenic
1093033186 12:14308072-14308094 CCTTTCCTCTTTCTAGTTTCTGG - Intergenic
1093626662 12:21357384-21357406 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1093772055 12:23029716-23029738 CCTTGCCTCTCCCTGGCATCTGG + Intergenic
1093827593 12:23713232-23713254 GCATGCCTCTCCCTAGCTTCTGG - Intronic
1094490143 12:30955671-30955693 CCTCGCCTCACCCCAGCTTCTGG + Intronic
1094642770 12:32292188-32292210 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1094737441 12:33250944-33250966 CCCTGCCTCTCCTTAGCTGCTGG + Intergenic
1095267201 12:40174365-40174387 CATTGCCTCTTCCTAGCTTCTGG + Intergenic
1095345681 12:41146642-41146664 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1095793139 12:46189071-46189093 CCTTGCCTTTCTCTTGCTCCAGG - Intronic
1096505455 12:52089655-52089677 CCTTGCCTCCGCCTCGCTTCCGG + Intergenic
1096704783 12:53412859-53412881 CATTGTCTCTCTCGACCTTCTGG + Intronic
1096863200 12:54545109-54545131 CCTTCCCCATCTCTAGCTCCTGG + Exonic
1097030036 12:56083326-56083348 TCCTGCCTCTCTCTAGGTCCTGG - Intronic
1097191406 12:57221252-57221274 CCCTGCCTCTTTCTAGGTGCAGG + Intronic
1097193775 12:57232865-57232887 CCTTGCCTTTCCCTGCCTTCAGG + Intronic
1097560415 12:61198252-61198274 CCTTGCCTCTTGATAGCTTCTGG - Intergenic
1097695077 12:62767797-62767819 CCTGGCCTCTTCCCAGCTTCTGG + Intronic
1098169447 12:67731875-67731897 CCTTCCATCTTCCTAGCTTCTGG + Intergenic
1098191915 12:67958246-67958268 CTTTGCCTCTTCCTAGCTTTTGG + Intergenic
1098204907 12:68098453-68098475 CCTTGCCTCTTCCTGGCTTCCGG + Intergenic
1098325942 12:69301386-69301408 CCTTGCCTCTTCCCAGCTTTTGG + Intergenic
1098608492 12:72424183-72424205 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1098766756 12:74500019-74500041 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
1098939217 12:76515706-76515728 CCCTGCCTCTGTGTCGCTTCTGG + Intronic
1100418900 12:94409758-94409780 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1100699754 12:97134679-97134701 CCTTGCCTCCTCCTAGCTGCTGG - Intergenic
1100825843 12:98473427-98473449 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
1100930129 12:99598967-99598989 CCTTGCCTTTTTTCAGCTTCTGG + Intronic
1101241749 12:102846005-102846027 CCTTGTATCTCTGTAGCCTCTGG + Intronic
1101319765 12:103663383-103663405 CCTTGCCTCCTTCTGGATTCTGG + Intronic
1101344592 12:103874757-103874779 CCTTGCCTCTCTCCAGCTTCTGG + Intergenic
1101364707 12:104061046-104061068 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1101425610 12:104585820-104585842 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1101448045 12:104752160-104752182 CCTTGCCTCTTCCCAGCTGCTGG + Intronic
1102009688 12:109610646-109610668 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1102239335 12:111314133-111314155 TCTTGCATCTCTCTTGCTACTGG - Intronic
1102703093 12:114856939-114856961 CCTGGCCTCTCCCTGTCTTCTGG + Intergenic
1103022232 12:117543844-117543866 CTTTGCCTCTTCCTACCTTCTGG + Intronic
1103033967 12:117641431-117641453 CCCTGCCTCTTCCTAGTTTCTGG + Intronic
1103456691 12:121072882-121072904 CTTTGCTTCTTTCTAGCTTCAGG + Intergenic
1103558504 12:121779885-121779907 CCTGGCCTCTCTCCAGCTCCGGG + Exonic
1103859080 12:123997466-123997488 CTTTGCCTCTTCCTAGCTTGTGG + Intronic
1104360794 12:128131003-128131025 CTTTACCTCTCTCTGTCTTCTGG - Intergenic
1104423259 12:128654337-128654359 CCCTGCCTCTTCCTAGCATCAGG - Intronic
1104755581 12:131267211-131267233 CCGTGGCTTTCTCCAGCTTCGGG + Intergenic
1106358251 13:29005315-29005337 TCTTGCCCCTCTCCAGCTGCTGG - Intronic
1106955680 13:34936024-34936046 CCTTGCCTCTTCCTCGCTTCTGG + Intergenic
1107340163 13:39396912-39396934 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1107451880 13:40517179-40517201 TCTTGCCTGTCCCTAGCTTCTGG - Intergenic
1107711330 13:43153187-43153209 CCTTGACTCTTCCTAGCTTCTGG + Intergenic
1107793966 13:44031137-44031159 CCTTGCCTCTTCCTAGATTCTGG + Intergenic
1108041108 13:46339998-46340020 CCCTGCCTCTCTCCGGCTTCTGG + Intergenic
1108185040 13:47880370-47880392 CCTTCCCTCTCTCTTTCTCCAGG - Intergenic
1108364691 13:49698154-49698176 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1108485071 13:50915571-50915593 CTTGGACTCTCTCTAGCTCCTGG - Intronic
1108562511 13:51659666-51659688 CCTTGTCTCTCTACAGCTGCTGG + Intronic
1108564281 13:51679788-51679810 CCTTGCTTTTTCCTAGCTTCTGG + Intronic
1108611335 13:52086917-52086939 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1109411133 13:61971005-61971027 CTTTGCCTCTCCTTAGCTTCTGG + Intergenic
1109689164 13:65863970-65863992 CCTTGCCTCATCCTGGCTTCTGG + Intergenic
1110098372 13:71561522-71561544 CCTTCGCTTTCTATAGCTTCTGG - Intronic
1110242373 13:73283375-73283397 CCTTGCCTCTTCCTAGCGTGTGG - Intergenic
1110347955 13:74470383-74470405 CCTTGCTTCTTTCTAGCTTCTGG + Intergenic
1110442375 13:75539540-75539562 CCTGGCCTCTTTCTATCTTAAGG + Intronic
1111038730 13:82715259-82715281 CCATGCCTCTTCCTAGCTTCTGG + Intergenic
1111551143 13:89814437-89814459 CCTTACCTCTTTCTAGGTTCTGG - Intergenic
1111967807 13:94878530-94878552 CCTTGCTTCTTTCTAGCTTCTGG - Intergenic
1112094765 13:96120188-96120210 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1112308123 13:98293726-98293748 CCCTGCCTTTCTCTAGGCTCAGG - Intronic
1112364553 13:98745634-98745656 CCAGGCCTTTCTCTTGCTTCTGG - Intronic
1112409100 13:99146718-99146740 CCAGGCCTTTCTCTTGCTTCTGG + Intergenic
1112537490 13:100274574-100274596 CCATGCCTCTCTCCTGGTTCTGG + Intronic
1112642308 13:101289676-101289698 TCTTGCCTTTCTCTAGCATATGG - Intronic
1112726479 13:102310590-102310612 CCTTGCCTCCCTCTATCTCCTGG - Intronic
1113017217 13:105841115-105841137 CCTTGCCACTGCCCAGCTTCTGG + Intergenic
1113032605 13:106010882-106010904 TCTTGCTTCTATCCAGCTTCTGG - Intergenic
1113150524 13:107258427-107258449 CATTACCTCTCTCTAGCTGCAGG - Intronic
1113360151 13:109623059-109623081 CCTTGCCTCTTGCTAGCTCCTGG - Intergenic
1113367852 13:109693411-109693433 CCCTGCCTCTCTCCAGCTTCTGG - Intergenic
1113568016 13:111330732-111330754 CCTTCCCTCTCTCTGGCCCCTGG + Intronic
1114602472 14:23967771-23967793 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114606841 14:24004897-24004919 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114612141 14:24049845-24049867 CCCTGCCTCTCTCTACCTTCTGG + Intergenic
1114988168 14:28254758-28254780 CCTTGCCTTTTTCTAGCCACTGG + Intergenic
1115004214 14:28461690-28461712 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1115039262 14:28901857-28901879 CCTTGCCTCTTTCTAGCCTCTGG - Intergenic
1115324663 14:32126336-32126358 CCTTGCCTCTTTCTTGCTTCTGG + Intronic
1115502837 14:34064614-34064636 CCTTGCTTCTTCCTAGCTTTTGG - Intronic
1115962377 14:38850077-38850099 CCTTGCCTTTTCCTAGCTTCTGG - Intergenic
1115986748 14:39110150-39110172 CATTGCCTCTCTCTAATTTATGG + Intergenic
1116064731 14:39968754-39968776 CTTTGCCTCTTTCCAACTTCTGG - Intergenic
1116627764 14:47287956-47287978 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1116750744 14:48880484-48880506 CCTTGCCTCCTCCTAACTTCTGG + Intergenic
1116808025 14:49512213-49512235 CTTTGCCTCTTCCTAGCTTTTGG - Intergenic
1116858150 14:49972020-49972042 GCTTCCCTTTCTGTAGCTTCTGG - Intergenic
1116965223 14:51007548-51007570 CCTTGCCACTCACTAGCTGTGGG + Intronic
1117299836 14:54413975-54413997 CCATGCCTCTTCCTAGCTTCTGG + Intronic
1117321612 14:54629230-54629252 CGTTGCCTCTTCCAAGCTTCTGG - Intronic
1117352430 14:54894368-54894390 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1117433838 14:55697745-55697767 CCCTGACATTCTCTAGCTTCTGG + Intronic
1117580881 14:57150625-57150647 CCTTGCCCCTCCCTAGCTTCTGG + Intergenic
1117599616 14:57361963-57361985 CCTTGCCACTCTCTAGCTTCCGG - Intergenic
1117680363 14:58197587-58197609 TCTTGCCTTTTCCTAGCTTCTGG - Intronic
1117744246 14:58851931-58851953 CCTTGCCTCTTACTAGTTTCTGG + Intergenic
1118461006 14:65987073-65987095 CATTGCCTCTTCCTGGCTTCTGG + Intronic
1118669544 14:68108593-68108615 TCCTGCCTCTCTCTAGATCCTGG - Intronic
1118715739 14:68558517-68558539 CCTTGCCTCTTCTCAGCTTCTGG + Intronic
1118847972 14:69562391-69562413 CCTTTGCTCTCTCCATCTTCAGG - Intergenic
1118869243 14:69727474-69727496 CCTGGCCTCTTTCTAGCTTTTGG + Intronic
1118916616 14:70112774-70112796 CCTTGCTTCTTCCTAGCTTCTGG + Intronic
1119334219 14:73819026-73819048 CCTTGCCTCTTCCTAGCTGCTGG + Intergenic
1119496977 14:75088391-75088413 TCTGGCCTCGCTCTAGCTTTTGG - Intronic
1120009716 14:79399874-79399896 CCTTGCCTTTTCCTAGCTTCTGG + Intronic
1120030492 14:79635582-79635604 CCTTGCCTCTTCATAGCTTCTGG + Intronic
1120092084 14:80343752-80343774 TCTTGCCTCTTCCCAGCTTCTGG + Intronic
1120215469 14:81677332-81677354 CTTTTCCTCTTTTTAGCTTCAGG - Intergenic
1120391330 14:83912079-83912101 CCTTCCCTCTTCTTAGCTTCTGG - Intergenic
1120396580 14:83974538-83974560 CCTTACCTCTTCCTAGCTTCTGG - Intergenic
1120408460 14:84119057-84119079 CCTTGCCTCTCTCTAAAAGCAGG + Intergenic
1120462838 14:84819165-84819187 CCTTGCCTCTTCTTAGCTTCTGG - Intergenic
1120647616 14:87092174-87092196 CTTTGCCTCTTCCTAGCCTCTGG - Intergenic
1120800156 14:88678980-88679002 CCTTGTTTCTCTCTAGCTTCTGG + Intronic
1120876910 14:89383561-89383583 CCTTGCCTCCTCCTGGCTTCTGG + Intronic
1121222420 14:92296530-92296552 CCTTGCCTCTTCCAAGCTTCTGG - Intergenic
1121316011 14:92961350-92961372 CCTTGGCTCTCTCTAGGGACAGG + Intronic
1121463273 14:94098272-94098294 CCATGCCACTCCCTAGTTTCTGG + Intronic
1121463473 14:94099531-94099553 CTGTGCCTCCTTCTAGCTTCTGG - Intronic
1121512649 14:94523690-94523712 CCTTGCCTCTTTCCAGCCTATGG + Intergenic
1121731246 14:96188687-96188709 CCAGGCCTCTCTGTAGCTTCTGG - Intergenic
1122083869 14:99286014-99286036 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1122119631 14:99545226-99545248 GCCTGCCTCTCCCCAGCTTCAGG + Intronic
1122202188 14:100129368-100129390 CCTTGTCCCTCTCTCGATTCTGG + Intronic
1122351968 14:101101543-101101565 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1122401461 14:101469829-101469851 CCTGGCCTTGCTCTTGCTTCAGG - Intergenic
1122447960 14:101782369-101782391 CCTTCCCTCTCTCTCCCCTCTGG + Intronic
1124111685 15:26795893-26795915 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1124462446 15:29904950-29904972 CCTTGCCTCTTCCTAGTTTCTGG - Intronic
1124681087 15:31731535-31731557 CCTTTCCTCCCTCTAGCCCCTGG - Intronic
1125504554 15:40259351-40259373 CCCTGCCTCTCCCCAGCATCAGG - Intronic
1125967667 15:43887309-43887331 AGTTGCTTCTCTCTAGGTTCAGG + Intronic
1126054491 15:44716901-44716923 TCCTCCCTCTCTCTTGCTTCTGG - Intronic
1126487697 15:49200610-49200632 CCCTGCCTCTTTCTACCTTCTGG - Intronic
1126534685 15:49748676-49748698 CACTGCCTCTGTTTAGCTTCTGG - Intergenic
1126568965 15:50129386-50129408 CCATGCCTCTCTTCAGCTTCTGG + Intronic
1127287311 15:57543138-57543160 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1127764593 15:62172757-62172779 TCTCGCCTCTTTCTAGCTTCTGG + Intergenic
1129057421 15:72830892-72830914 CCATGCGTCTCCCTGGCTTCTGG + Intergenic
1129958842 15:79664845-79664867 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1130200321 15:81819961-81819983 CCTGGCCTCTTCCTAGCTTCTGG + Intergenic
1130288119 15:82572148-82572170 CCTGGACTCTCTCCAGCTGCTGG + Intronic
1130342962 15:83014565-83014587 CTCTGCCTCTCTCTCCCTTCAGG - Intergenic
1130877285 15:88025609-88025631 CCTTTCCTCTTCCTAGTTTCTGG - Intronic
1130981156 15:88812547-88812569 CCTGGCCTCTCACTTCCTTCAGG + Intronic
1130981643 15:88815978-88816000 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1131060837 15:89403705-89403727 CCTTGCCTGGATCTAGCATCTGG - Intergenic
1132276381 15:100568525-100568547 CCCTGCCCCTTTCTGGCTTCTGG - Exonic
1132286905 15:100670004-100670026 CCAGGCCTCTCTCTAGCTTCGGG + Intergenic
1133403844 16:5507821-5507843 CCTTGCGTCTTCCCAGCTTCTGG - Intergenic
1133640912 16:7716547-7716569 CCTAGCCTTGCTCAAGCTTCTGG - Intergenic
1133819695 16:9225676-9225698 TCTCGCCTCTCTGCAGCTTCTGG - Intergenic
1134077496 16:11302201-11302223 CCATGCCTCTCCCTAGCTTCTGG + Intronic
1134281173 16:12818459-12818481 TCTTGCCTCTTCCTAGTTTCTGG - Intergenic
1134742966 16:16564401-16564423 CCTTGCATCTCTCACTCTTCTGG - Intergenic
1134859635 16:17549742-17549764 CCTGGCCTCTTTCTGGCTTATGG + Intergenic
1134924594 16:18148059-18148081 CCTTGCATCTCTCACTCTTCTGG + Intergenic
1135396353 16:22134626-22134648 CCTTGCCCCTCCCTGGCTTCTGG + Intronic
1135820763 16:25683486-25683508 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1135835932 16:25825201-25825223 ACTTGCCTCTTCCTAACTTCCGG - Intronic
1136009085 16:27350838-27350860 CCTTGCCTCCCTTTCCCTTCTGG - Intronic
1136040659 16:27576189-27576211 CTCTGTCTCTCTCTAGCTACGGG + Intronic
1137004598 16:35262618-35262640 CCTTCACTCTCCCTAGCCTCTGG - Intergenic
1137013729 16:35351175-35351197 CCTTCACTCTCCCTAGCATCTGG - Intergenic
1137931096 16:52588426-52588448 CCCTGCCTGTCTCTAGCTCTAGG + Intergenic
1138146262 16:54614900-54614922 GCTGGCATCTGTCTAGCTTCCGG - Intergenic
1138304861 16:55965303-55965325 CCTTGCCTCTTTCAAGCTTCTGG + Intergenic
1138416759 16:56876086-56876108 CCTTGCCTCTTCCTAATTTCTGG + Intronic
1138613766 16:58148111-58148133 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
1138624017 16:58234982-58235004 TCTTGCCTCTTCCCAGCTTCTGG - Intronic
1138646688 16:58430710-58430732 CCTTGCCTCTTCCTAATTTCTGG + Intergenic
1138909049 16:61374521-61374543 TCTTGCCTCTTTCTATCTTCTGG + Intergenic
1139341306 16:66269910-66269932 CCCTCCCTCTCTCTAACTGCTGG - Intergenic
1139517944 16:67462850-67462872 CCATGCCCATGTCTAGCTTCTGG + Intronic
1140175761 16:72658101-72658123 CCTACCCTCTCCCTAGCTTCTGG + Intergenic
1140309479 16:73835274-73835296 ACATGTCTCTCTCTAGCTTTGGG + Intergenic
1140891946 16:79292366-79292388 CCTTGCCTCTAACTAGCTTCTGG - Intergenic
1141025651 16:80544776-80544798 CCTTACCTCTTCCTAGCTTCTGG + Intronic
1141055666 16:80811429-80811451 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
1141154251 16:81586041-81586063 CCATTGCTCCCTCTAGCTTCAGG + Intronic
1141337794 16:83173726-83173748 CCCTGCCTCTCCCAATCTTCTGG + Intronic
1142252101 16:88996709-88996731 CCAGGCCTCTCTCCAGGTTCTGG + Intergenic
1142323903 16:89401908-89401930 CCAGGCCTCTCTCCAGGTTCTGG - Intronic
1142877713 17:2862101-2862123 CCTTGCCTCTGCATAGCTTTGGG + Intronic
1142962798 17:3561550-3561572 CCGTCCCTCTCTCCAGCTCCTGG - Intergenic
1143760040 17:9095239-9095261 CCTTGCCTCTGTTTTGCTTCTGG + Intronic
1144159711 17:12545875-12545897 ACTTGCTTCTTTCTCGCTTCTGG + Intergenic
1144160570 17:12553691-12553713 CCATGCCTTCCTCCAGCTTCTGG + Intergenic
1145182131 17:20762416-20762438 CCTTGCCTTCTTCCAGCTTCTGG - Intergenic
1145993096 17:29090920-29090942 CTTTGCCTCTCTCCAGCTGGAGG - Exonic
1146147684 17:30435841-30435863 CCTTGTTTCTCCCTAGTTTCTGG + Intronic
1147347834 17:39814720-39814742 TTTTGCCTCTTTCTGGCTTCTGG - Intronic
1148368602 17:47075993-47076015 CCTTGTCTTTTTCCAGCTTCTGG - Intergenic
1149305836 17:55345847-55345869 CCTTGGCTCTTCCTAGATTCTGG - Intergenic
1149841933 17:59972968-59972990 CCTTGCCTTCTTCCAGCTTCTGG - Exonic
1150165008 17:62933037-62933059 CCTTGCCTTTTCCTGGCTTCTGG - Intergenic
1150596803 17:66613583-66613605 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1151011689 17:70505611-70505633 CCCTGCCTCTTCTTAGCTTCTGG - Intergenic
1151326589 17:73383550-73383572 CCTTGCCTGTCCCTGGCTTTAGG + Intronic
1151350607 17:73529750-73529772 CCATGCCTGTCTCTAGCTTTTGG - Intronic
1151955332 17:77377281-77377303 CCTTTCCTCTTTCTCCCTTCTGG + Intronic
1151992695 17:77587744-77587766 ACTTTCCTCTCCCTAGCTACAGG + Intergenic
1152471647 17:80492855-80492877 CCTTGCCTGTCCCCAGCTCCAGG + Intergenic
1152471657 17:80492906-80492928 CCTTGCCTGTCCCCAGCTCCAGG + Intergenic
1152818054 17:82420432-82420454 CCTTGCTTCTCTCTAGCTTCTGG - Intronic
1153771487 18:8420480-8420502 CCTTGCCTCCTCCGAGCTTCCGG + Intergenic
1153825063 18:8867488-8867510 CCGTTCCTCCCTCTAGCTCCTGG - Intergenic
1155072248 18:22326842-22326864 CCTCGCCTCTCCCTAGGTTCTGG - Intergenic
1156128431 18:33937216-33937238 CCTTGCCACTGGCTTGCTTCAGG + Intronic
1156163982 18:34395641-34395663 CCTTGCCTCTTCCTATCTTCTGG - Intergenic
1156167059 18:34434708-34434730 TTCTGCCTCTTTCTAGCTTCTGG + Intergenic
1156455819 18:37293310-37293332 CCTTGCCCCTTCCTAGCTTCTGG + Intronic
1156741762 18:40339385-40339407 CCTTGCCTATTTCTAGCTTATGG + Intergenic
1156815257 18:41302705-41302727 TCTTGTCTTTCGCTAGCTTCAGG + Intergenic
1156917082 18:42474339-42474361 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
1158048677 18:53188776-53188798 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1158077961 18:53553191-53553213 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1158719923 18:59915676-59915698 CCTTGCCTCCTCCTAGCATCTGG + Intergenic
1158868498 18:61661227-61661249 CCTTGCCTCTTCCTACCTTCTGG - Intergenic
1158915999 18:62130085-62130107 CCTTGCCTCTACCTAGCTTCTGG - Intronic
1158973322 18:62688335-62688357 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1159014906 18:63093366-63093388 CCTTGCCTCTTCCTGGCTCCCGG + Intergenic
1159041308 18:63325469-63325491 TCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1159128091 18:64248200-64248222 TCTTGCCTCTTTCTAGCATCTGG + Intergenic
1159389635 18:67773056-67773078 CCTTGTCTCTCTCTTGTTACAGG + Intergenic
1160415392 18:78706384-78706406 CCTGGGCTCTCTCTGGCTTCCGG - Intergenic
1160903472 19:1440780-1440802 CCTGGCCTCACTCTGTCTTCTGG + Exonic
1161981996 19:7634782-7634804 CCTTGCCCCTCCCTGGCTTTTGG + Intronic
1161999892 19:7737307-7737329 CCCTGCGTTTCTCTAGATTCTGG - Intergenic
1162005998 19:7779706-7779728 CCCTGCCTCTCCCTAGATTCTGG + Intergenic
1162029920 19:7912886-7912908 CCCTGCCTCTGTCTCTCTTCTGG + Exonic
1162066801 19:8130982-8131004 CCGGACCTCTCTCCAGCTTCTGG - Intronic
1162148443 19:8628258-8628280 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
1163055471 19:14714441-14714463 CCTTGCCCCTCCCTGGCTTCTGG - Intronic
1163478988 19:17543397-17543419 CCCTGACTCTCTCCAGCCTCTGG - Exonic
1163509134 19:17725069-17725091 CCCTGCCTCTCACAAGCTACTGG + Exonic
1163638409 19:18448542-18448564 CCTTGCCTCTCACTTCCTTCTGG - Intronic
1163777611 19:19227372-19227394 CCTCGGCTTTCTCTAGCTCCAGG - Exonic
1164625219 19:29723385-29723407 CCCTTCCTCTCTCTATTTTCGGG - Intergenic
1165741331 19:38206876-38206898 CCTTGCCTCTCTCTATCCTCAGG - Exonic
1166702075 19:44888088-44888110 CCTGTCCTCTCTCTACCTCCAGG + Exonic
1166987200 19:46668076-46668098 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1167985107 19:53308291-53308313 CCTCTCCTCCCTCTAGCTACTGG + Intergenic
1168207170 19:54859436-54859458 CCTTCCCTCTCTCAAGCCCCCGG - Intronic
1168533676 19:57151078-57151100 TCTTGGCTCACTGTAGCTTCCGG + Intergenic
1168670052 19:58234210-58234232 CCTTGCCTTTCTCTATGCTCAGG + Intronic
925006296 2:445317-445339 CTCTGCATCTCTCTAGCGTCTGG + Intergenic
925529707 2:4845723-4845745 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
925687469 2:6487793-6487815 CCTTGCCTGCTCCTAGCTTCTGG + Intergenic
925749018 2:7070795-7070817 CTTGGCTTCTCCCTAGCTTCTGG - Intergenic
926028253 2:9563567-9563589 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
926231769 2:11009886-11009908 CCTCACCTCCCTCAAGCTTCCGG - Intergenic
926705618 2:15835397-15835419 CCTTGCCTCTCCCCAGCTTCTGG + Intergenic
926722196 2:15969086-15969108 CCCTGCCTCTTTCTAGCTTTGGG + Intergenic
926772974 2:16394315-16394337 CCTTGCCCCTCTCTGGGTTCTGG + Intergenic
927098851 2:19771318-19771340 CCATGCCTCTCCCCAGCTTCTGG + Intergenic
927358559 2:22204669-22204691 CATTGACTTTCTCCAGCTTCTGG - Intergenic
927399670 2:22696484-22696506 CCTTGCCTCTTCCTAGATTCTGG - Intergenic
928224835 2:29439801-29439823 CCTTACCACTTCCTAGCTTCTGG - Intronic
928252092 2:29689919-29689941 CCATGCCCCACTCCAGCTTCTGG - Intronic
928653245 2:33423596-33423618 CCTTGCCTCTTTCTAACTTATGG + Intergenic
929558626 2:42941720-42941742 CCTTGCTTCTCTCTTGATTTTGG + Intergenic
929875255 2:45791429-45791451 CCTTGCCCCCTTCTAGTTTCAGG + Intronic
930067545 2:47339340-47339362 CCTTGCCTCTTTCTTACTTCTGG - Intergenic
930274042 2:49290786-49290808 CCTTGCCTCTTACTAGCATCTGG - Intergenic
930633902 2:53784571-53784593 CCTTGCCTCTTCCTAGCTTGTGG + Intronic
931046664 2:58361914-58361936 GCTTGCCTTTTCCTAGCTTCCGG + Intergenic
931687821 2:64809709-64809731 CCTTGCCTCTTCCTGGCCTCTGG + Intergenic
931776400 2:65544732-65544754 CCTTACCTCTCTGTGGCTTTTGG + Intergenic
931902670 2:66806862-66806884 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
931932892 2:67160792-67160814 CCTCGCCTCTTCCTAGCTTTTGG - Intergenic
931973906 2:67621860-67621882 CCATGCCTTCCTCTGGCTTCTGG + Intergenic
932008653 2:67953615-67953637 CCTTGACTCCTCCTAGCTTCTGG - Intergenic
932928170 2:76001195-76001217 TCTTGCCTCTTCCTAGTTTCTGG + Intergenic
932950753 2:76290035-76290057 CCGTGCCTCTCCCAAACTTCTGG + Intergenic
933233437 2:79836631-79836653 CCTTGCTTCTTCCTAGCTCCTGG + Intronic
934049524 2:88198679-88198701 CCAAGCCTGTCTCCAGCTTCTGG - Intergenic
934812807 2:97297653-97297675 CCTTGGCTCTTTGTCGCTTCTGG - Intergenic
934824888 2:97410819-97410841 CCTTGGCTCTTTGTCGCTTCTGG + Intergenic
935300158 2:101686807-101686829 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
935655591 2:105420219-105420241 CCATGCCTCTCCCTAGCTGCTGG + Intronic
935673314 2:105573554-105573576 CGTTGCCCCTCTCTAGCTCCTGG - Intergenic
935714267 2:105926225-105926247 CCTTGCCGCATTCTAGTTTCAGG - Intergenic
936512490 2:113159417-113159439 TCATGCCTCGCTCTGGCTTCAGG - Intronic
936519718 2:113204101-113204123 GCTTGCATCTTTCTAGCTTCTGG + Intronic
936947625 2:117944885-117944907 CCTTTCCTATCTCTTTCTTCTGG + Intronic
936968200 2:118147891-118147913 CTTTGCCTCTTCCTAGTTTCTGG + Intergenic
936980824 2:118263642-118263664 CCCTCCCTCTCGCTCGCTTCTGG - Intergenic
937287316 2:120761667-120761689 CCCTGCCTCCCTCAAGCTGCCGG + Intronic
938418855 2:131127265-131127287 TCTTGCCTCTTCCTAGCTTCTGG + Intronic
938781178 2:134586360-134586382 CCAGCCCTCTCTCTAGCTGCTGG + Intronic
938954642 2:136286522-136286544 CCTAGCCTCTTTCTCACTTCTGG + Intergenic
939283858 2:140102389-140102411 CCTGGCCTCTTTCTATCTTCTGG - Intergenic
939289132 2:140170505-140170527 TCATGCCTCTCTTTAGCTACTGG - Intergenic
939475541 2:142681633-142681655 TCTTTCCTCTTTCTAGCTTCTGG - Intergenic
939662691 2:144910036-144910058 CCTTGTCTCTTACTAGCTTTGGG + Intergenic
939870186 2:147518183-147518205 CCATGTCTTTCTCTAACTTCTGG + Intergenic
940074975 2:149731621-149731643 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
940179343 2:150914547-150914569 CCTTGCCTCTCTCTGGCTTCTGG + Intergenic
940779141 2:157914800-157914822 CCTTGCCTCTTCTTAGCTTCTGG + Intronic
940791868 2:158037567-158037589 CCATGCCTCTCTTTAGCTTCTGG + Intronic
941002187 2:160213764-160213786 CCCTCCCCCTCCCTAGCTTCCGG + Intronic
941043053 2:160644856-160644878 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
941562288 2:167061787-167061809 CCTTGCCTTTTCCTAGCTTTCGG - Intronic
942246651 2:174013959-174013981 CATTGCCTCTGGCTAGCTTAGGG + Intergenic
942326824 2:174782839-174782861 CCTCGCCTCTCCCTAGCATAGGG + Intergenic
942385484 2:175438545-175438567 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
942519977 2:176793292-176793314 CCCTGCCTCACTCTGGCTTTTGG + Intergenic
943511654 2:188834320-188834342 CCCTTGCTCTCTCTTGCTTCTGG + Intergenic
944101610 2:196033457-196033479 CCCTGCCTCCCTCCAGCCTCTGG + Intronic
944882310 2:204026140-204026162 CCTTCCCTTTTCCTAGCTTCTGG + Intergenic
945459049 2:210083159-210083181 CTTTGCCTCTTCCTAGCTTCTGG - Intronic
945620335 2:212127848-212127870 CCTTGCCACTCTCTAGCTTCTGG - Intronic
946184306 2:217970139-217970161 CCTTGCCTCTTTCCAGCTTCTGG - Intronic
946493322 2:220171063-220171085 CCTTGCCTCTTCCTAGCCTCTGG - Intergenic
946530040 2:220560776-220560798 CCATTCCTCTCCATAGCTTCTGG - Intergenic
946763961 2:223022884-223022906 TCATGCCTCTCCCTGGCTTCTGG + Intergenic
947032024 2:225807146-225807168 CCATGCCTCTTCCCAGCTTCTGG - Intergenic
947345189 2:229183243-229183265 CCATACCTCTCCCTGGCTTCAGG - Intronic
947803254 2:232945591-232945613 CCCCGCCTCTCTCTGGCTTCTGG - Intronic
947953623 2:234169329-234169351 CCTGGCCTCTTTCCAGCTTCTGG + Intergenic
947989807 2:234477716-234477738 CCAGGCCTCTCTCCAGCTCCTGG - Intergenic
948262686 2:236615707-236615729 CCTTGACTCTTCCTGGCTTCTGG + Intergenic
948390206 2:237606461-237606483 CCTGGCCTCTCTCTGGCCTCTGG - Intergenic
948398069 2:237662110-237662132 CCAGGCGTCTCTCCAGCTTCTGG + Intronic
948639837 2:239368662-239368684 CCATGCCTGTCTCAAGCTGCAGG + Intronic
948658154 2:239489695-239489717 CCATGCCTGTCTCTAGGTGCTGG + Intergenic
948699423 2:239750884-239750906 CATTGCCTCTCTCTGTCTTTGGG - Intergenic
948711039 2:239825727-239825749 CCAGGCCTCTCTCCAGCCTCTGG - Intergenic
1168794767 20:604175-604197 CTGTGCCTCTCTCTAGGTCCAGG + Exonic
1169396368 20:5234001-5234023 CCTCCCCTCTCTCTAGCTTCTGG - Intergenic
1169490851 20:6070395-6070417 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1169792986 20:9431148-9431170 CCTTGCCTCTTTCTGGCTTCTGG + Intronic
1170848827 20:19985183-19985205 CCTTGTCTATCTCCAGCCTCTGG + Intronic
1171109901 20:22471443-22471465 CCATGCCTCCCCCCAGCTTCTGG + Intergenic
1171208776 20:23301306-23301328 CCATGCATCTCCCTGGCTTCTGG - Intergenic
1172307054 20:33888311-33888333 CCTTGCCTCTGCCTAGCTCCTGG + Intergenic
1172671036 20:36634578-36634600 CCTTGCTTCTCTCTAGATGGAGG + Exonic
1173070446 20:39759362-39759384 CTTTGCCTCTCACTAGCTGTGGG - Intergenic
1173398935 20:42707042-42707064 CCTTGCCTCTTCCTGGCTTTTGG - Intronic
1173531976 20:43776740-43776762 CCTTGCCTCTTCCTGGCTTTTGG + Intergenic
1173680957 20:44881468-44881490 CCATGCCTCTTCCTGGCTTCTGG + Intergenic
1174455952 20:50648998-50649020 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1174689757 20:52492189-52492211 CCTTCCCTATCTCCATCTTCTGG - Intergenic
1174978444 20:55362168-55362190 GCCTGCCTCTTTCTAGTTTCTGG - Intergenic
1175194518 20:57233635-57233657 CCTTGCCTCTCCCTAACATCTGG + Intronic
1175349968 20:58310275-58310297 CCTTGCCTCTCTATTGCATCTGG + Intronic
1175564501 20:59962392-59962414 CCTGGCCTCTCCCCAGCTTCTGG + Intronic
1176130223 20:63493690-63493712 CCTCGCCCCACCCTAGCTTCTGG + Intronic
1176231933 20:64037241-64037263 CCTTCCTCCTCTATAGCTTCTGG + Intronic
1176788550 21:13290003-13290025 CTATGTCTCTCTCTTGCTTCAGG - Intergenic
1176965427 21:15207175-15207197 CCTTGCCTCCTCCTAGTTTCTGG - Intergenic
1177137901 21:17326563-17326585 CCTTGCCTCTTCACAGCTTCTGG + Intergenic
1177208909 21:18045505-18045527 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1177543961 21:22532875-22532897 CCCTGCCTTTTTCTAGCTTCTGG - Intergenic
1177821308 21:26033659-26033681 CCTTGCCACTCTTCTGCTTCAGG - Intronic
1178114363 21:29402065-29402087 CCTTGCCTCTTCCTAACTTCTGG - Intronic
1178211286 21:30535841-30535863 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1178307210 21:31500745-31500767 CCATGCCTCTTCCTAGTTTCTGG - Intronic
1178352233 21:31880444-31880466 CCTTGCCTCTTACTAGCTTCCGG + Intronic
1178361710 21:31953975-31953997 CTTTGCCTCTCTCCATCATCTGG - Intronic
1178750593 21:35299078-35299100 CCTTGCCTCTTCCTAGCTCCTGG - Intronic
1178818194 21:35950782-35950804 CCATGCCTCTTTCTAGCTTCTGG + Intronic
1179487383 21:41719168-41719190 CTGTGCCCCTCTCCAGCTTCTGG + Intergenic
1179588728 21:42390894-42390916 CCCTGCCTCTTCCTAGCTCCTGG - Intronic
1180198968 21:46213506-46213528 CCCTTCCTCACTCTACCTTCTGG + Intronic
1181338340 22:22158436-22158458 CCTTCCCTCTTTCTGGCTGCTGG - Intergenic
1181477846 22:23179873-23179895 CCTGGCCTCTCACCAGCCTCAGG - Intronic
1182111892 22:27729559-27729581 CATTGCCTCTTTCTGCCTTCAGG - Intergenic
1182471333 22:30550125-30550147 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1183273876 22:36879057-36879079 CCTTGCCTTTTCTTAGCTTCTGG + Intergenic
1183311927 22:37114715-37114737 CCTTGTCTCTTGCTAGCTTTCGG + Intergenic
1183468410 22:37992124-37992146 CCATGCCTGGCTCTAGCTCCAGG + Intronic
1183579669 22:38716411-38716433 CCTTAACTCCCACTAGCTTCTGG - Intronic
1183667442 22:39253866-39253888 CCTTTCCTCTCTCCAGCTGCAGG - Intergenic
1184975226 22:48057136-48057158 CCTTCTCTCTCTCTCTCTTCAGG - Intergenic
1185075915 22:48682213-48682235 CCCTGCCACTCTCCAGCCTCAGG + Intronic
1185094288 22:48797847-48797869 CCAGGCCTCTCTCCAGCTTCTGG + Intronic
1185206591 22:49542190-49542212 GCTGGCCTCTCTCTAGCTTTAGG + Intronic
1185259881 22:49855704-49855726 CTTTGCCTGGCTTTAGCTTCTGG + Intronic
1185383311 22:50520333-50520355 CCTTGACTCTCTCTAGGCTCAGG + Intronic
949160561 3:876743-876765 CCTTGCCTCTTCATAGCTTTTGG + Intergenic
949369980 3:3324403-3324425 CCTTGCCTCTCCCTAGCTTCTGG - Intergenic
949389318 3:3541757-3541779 CCTTGTCTCTTCCTAGCTTCTGG + Intergenic
949558025 3:5175723-5175745 CCTTGCCTCTCTCTAGCTTGTGG + Intronic
949767351 3:7541928-7541950 CCTTGCCTCTTCCTAGCTTTTGG + Intronic
949996715 3:9623081-9623103 TCTTGCCTCTCCCTGGCTTCAGG - Intergenic
950565573 3:13767865-13767887 CCTGGCCTCTCTAATGCTTCTGG + Intergenic
950736128 3:15009843-15009865 CCTTGCCTCTTCCTACCTTCTGG + Intronic
950969449 3:17171501-17171523 CCTTGACTCTGCTTAGCTTCTGG + Intronic
950979652 3:17288923-17288945 CCTTGCCTCACTCTGGCTCATGG - Intronic
951066687 3:18275192-18275214 CCTTGCCTTTTCCTAGCTTATGG - Intronic
951184643 3:19698896-19698918 CCTTGCCTCTTTCTCTCATCTGG + Intergenic
951220696 3:20066105-20066127 CCTTGCCTCTTCCTAGCATCTGG + Intronic
951618998 3:24580147-24580169 CCTTGCCTCTTGCTATCCTCCGG - Intergenic
951661353 3:25070065-25070087 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
951756681 3:26098458-26098480 CCTTGCCTCTTTCTGGCTCTTGG + Intergenic
951884832 3:27514121-27514143 CTTTTCCTCCCTCTAGCTCCTGG + Intergenic
952604583 3:35129681-35129703 TCTGGCCTCTTTCTAGCTTTTGG - Intergenic
952790761 3:37198859-37198881 CCTTCCCTCTCTTAATCTTCCGG - Intergenic
953051168 3:39345294-39345316 CCTTGACTCTTCCTAGCTTCTGG - Intergenic
953877278 3:46673556-46673578 CCTTACCTCCCTGGAGCTTCTGG - Intronic
954602401 3:51879653-51879675 CCTTTCCTCTTCCTAGCTTTGGG + Intergenic
954858743 3:53669591-53669613 CCTTGCTTCTCACTAGTGTCTGG + Intronic
955064954 3:55526164-55526186 CCTTGCCTCTTCCGAGCTTCTGG - Intronic
955499478 3:59569958-59569980 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
955692412 3:61603711-61603733 CCTTGCCACTTTGTAGCTTCTGG + Intronic
955723733 3:61910455-61910477 CCTTGCCTTTCTCTTGTTGCTGG + Intronic
955857880 3:63293680-63293702 TCATGCCTCTCTGTAACTTCTGG + Intronic
956116315 3:65922526-65922548 CCTTGTCTCTTTCTAGCTTCTGG - Intronic
956319845 3:67984627-67984649 CCTTTCCTCTTCCTAGCTTCTGG + Intergenic
956581396 3:70818245-70818267 CCTTGCCTCCTCCTAGGTTCTGG - Intergenic
956916919 3:73881281-73881303 TCTTGCCTTTTTCAAGCTTCCGG + Intergenic
956964591 3:74444003-74444025 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
957037268 3:75305935-75305957 CTTTGTCTCTTCCTAGCTTCTGG + Intergenic
957219019 3:77358225-77358247 CCATGCCTTTTCCTAGCTTCTGG + Intronic
957261616 3:77909313-77909335 CATTGCCTCTTTCTAGGTACAGG - Intergenic
957339081 3:78870010-78870032 CCTGGCCTTTCTATAGCTTTTGG + Intronic
957429618 3:80085146-80085168 CCAAGCCTCTTTCTAGCTTCTGG - Intergenic
958024728 3:88037505-88037527 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
958043750 3:88257780-88257802 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
959019877 3:101177400-101177422 CCTGGCCTCACTATACCTTCAGG + Intergenic
959150097 3:102597867-102597889 GCTTGCCTCTTCCTAGCTTCTGG + Intergenic
959283810 3:104381283-104381305 CCTTTCCTCTCTCCATCTTTTGG - Intergenic
959379780 3:105628186-105628208 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
959620985 3:108398305-108398327 CCTTGCCCCTTCCTAGTTTCTGG - Intronic
959764396 3:110008039-110008061 CCTTGATTCTTTCCAGCTTCTGG + Intergenic
959873459 3:111354592-111354614 CTTTGCCTCTTTCTAGCTTCTGG - Intronic
959968929 3:112386302-112386324 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
959991828 3:112639209-112639231 ACTTGCCCTTCTCCAGCTTCAGG + Exonic
960082669 3:113557621-113557643 CCTTGCCTCTTCCTGCCTTCTGG - Intronic
960411286 3:117328801-117328823 CCTTGCCTTTCTTTAGATTTTGG - Intergenic
961081101 3:124029066-124029088 CTTTACCTCTTTCTAGCTTCTGG + Intergenic
961821017 3:129575671-129575693 CCCTGCCTCTCTCTACCTTCTGG - Intronic
961850823 3:129816567-129816589 CCTTGCCTTTCCCAAGCCTCTGG - Intronic
962159127 3:132980366-132980388 CCTTGCCTCTTCTGAGCTTCTGG - Intergenic
962337076 3:134544043-134544065 CCTACCCTCTCTCTGGCTTATGG + Intronic
962360140 3:134733709-134733731 CCTTACCTCCTTCTAGCTTCTGG - Intronic
962686833 3:137856056-137856078 CCTTGCCTCTTTCTGGCTTCTGG + Intergenic
962750505 3:138431636-138431658 CCTTGCTTCTTTCCAGCTCCTGG + Intergenic
963372525 3:144419432-144419454 CCATTCCCCTTTCTAGCTTCTGG + Intergenic
963423559 3:145093874-145093896 CCTTGCCTTTTTTTAGCTCCTGG - Intergenic
963485887 3:145934043-145934065 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
963668864 3:148226480-148226502 CCTTGCATCCTCCTAGCTTCTGG - Intergenic
963895997 3:150685428-150685450 CCTTCCCTCTTCCTAGCTTGTGG - Intronic
964221009 3:154344735-154344757 TCTTGCCTCTCCCTAGCTTCTGG - Intronic
964251708 3:154725458-154725480 TCTAGTCTCTTTCTAGCTTCCGG + Intergenic
964621060 3:158720549-158720571 CCTTGCCTCTTCCTAGTTTTAGG + Intronic
965002887 3:162980512-162980534 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
965312003 3:167140000-167140022 CCTTTCTTCCTTCTAGCTTCTGG - Intergenic
965417444 3:168414601-168414623 CCTTGCCTCTGTCTGAATTCTGG + Intergenic
965907651 3:173728775-173728797 CTTTGCGTCTTCCTAGCTTCTGG - Intronic
966043552 3:175521754-175521776 CCTTGCCTCATTTTAGCTTATGG - Intronic
966625031 3:182006445-182006467 CCCTGACTCCCTCCAGCTTCTGG + Intergenic
966811558 3:183850271-183850293 CCTCCCCTCTTCCTAGCTTCTGG + Intronic
966911950 3:184564703-184564725 CCTTCCCTCTCTGGAGCTGCAGG - Intronic
967637194 3:191816586-191816608 CTTTTCCCCTTTCTAGCTTCTGG - Intergenic
967660922 3:192108901-192108923 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
967726027 3:192863187-192863209 CCTTGCCTCTTCCTAGCCTCTGG - Intronic
967835545 3:193959507-193959529 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
967855469 3:194114180-194114202 CCTTGCCTCTTCCTAGTCTCTGG + Intergenic
968131854 3:196196732-196196754 CCCTGCCTCTCTGGAGCCTCTGG - Intergenic
968844321 4:3031504-3031526 CCCGGCCTCTCTCTAGCTGCTGG - Intronic
969119091 4:4894026-4894048 CCATGCCTCTTTCTAACTTTAGG + Intergenic
969208640 4:5669098-5669120 CTTTGCCTCTTCTTAGCTTCTGG - Intronic
969297135 4:6276835-6276857 CCTCGCCTCTGTCCAGCTTCTGG + Intronic
969359165 4:6650744-6650766 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
969468946 4:7375108-7375130 CCTTGTCTAACTCTGGCTTCTGG + Intronic
969714262 4:8860922-8860944 CCTGGCGTCTCTCTGGCGTCTGG - Intronic
969965704 4:10993244-10993266 CCAGGCCTCCCTCCAGCTTCTGG - Intergenic
969973016 4:11067358-11067380 CCTTGTCTCTTTTTAGCTGCTGG + Intergenic
970221886 4:13820255-13820277 TCTTGCCTCTTTCTGGCCTCTGG - Intergenic
970239121 4:13989665-13989687 CCTTGCCTCTTTCTAGCTTCCGG + Intergenic
970314780 4:14818816-14818838 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
970362305 4:15322243-15322265 CCTTGTCTTTTTTTAGCTTCTGG + Intergenic
970638879 4:18041284-18041306 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
970789174 4:19836237-19836259 CCTTACCCCTATCCAGCTTCAGG - Intergenic
970892488 4:21063121-21063143 CCCTGCCTCTCCCTAGCATCTGG - Intronic
971243300 4:24907857-24907879 CCTTGCCTCGTCCTAGTTTCCGG + Intronic
971259921 4:25046782-25046804 CCATGCCTCTCCCTAGCTTCTGG + Intergenic
971267183 4:25105989-25106011 CCATGCCCCTCCCTAGCTCCTGG - Intergenic
971277744 4:25214438-25214460 CATTGCCTCTTCCCAGCTTCTGG - Intronic
971364431 4:25966252-25966274 CCTTGCCTCTTCCTACCTTCTGG + Intergenic
971391915 4:26193994-26194016 CATTCCCTCTCTCTTCCTTCAGG + Intronic
971451683 4:26806881-26806903 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
971474018 4:27055730-27055752 CCTTTTCTCTCTCTCTCTTCAGG - Intergenic
972369283 4:38407176-38407198 CCTTGCCTCTTGCTAGCTTCTGG - Intergenic
972605480 4:40609722-40609744 CCTCATCTCTCTCTAGGTTCCGG + Intronic
972649556 4:41003638-41003660 CCTTGCCTCTTCCAAGCTTCTGG - Intronic
972957609 4:44411831-44411853 CCATGCCTCTTCCTAGCTGCTGG - Intronic
973815126 4:54612440-54612462 CCTTGCCTCTTCCTAGATTTGGG - Intergenic
973967789 4:56181667-56181689 CCTTGGCTCTTCCTGGCTTCTGG + Intronic
974384748 4:61189938-61189960 CCTTGTCTCTTCCCAGCTTCTGG - Intergenic
974539191 4:63211472-63211494 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
974836973 4:67262862-67262884 CCTTGCCTTTTCCCAGCTTCTGG + Intergenic
975701519 4:77071467-77071489 CCTTGCTTCTGTCTTGCTTTAGG - Intronic
976046673 4:80956557-80956579 CATTTCCCCTCTCTAGCCTCTGG + Intronic
976478499 4:85511858-85511880 CCTTTCCTCTTCCTAGTTTCTGG + Intronic
976598482 4:86915923-86915945 CATTCCCTCTTCCTAGCTTCCGG - Intronic
977110849 4:92952947-92952969 CTTTGCCACTTCCTAGCTTCTGG + Intronic
977138685 4:93339472-93339494 TCTTGCCTCTTCCTAGCTTTTGG - Intronic
977336162 4:95702069-95702091 CCTTACCTCATCCTAGCTTCTGG - Intergenic
977379065 4:96247244-96247266 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
977545812 4:98375172-98375194 TTTTGCCTCTTTGTAGCTTCTGG + Intronic
977907871 4:102499281-102499303 CTTTGCCTCCTCCTAGCTTCTGG - Intergenic
977987894 4:103406232-103406254 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
978061401 4:104344744-104344766 CCGTGGCTCTCTCTAGATTTTGG + Intergenic
978326173 4:107559299-107559321 CCATGCCTCTTCCTAGCTTCTGG - Intergenic
978815255 4:112897195-112897217 CCTTGCATAGCTATAGCTTCTGG + Intronic
979031302 4:115651635-115651657 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
979199448 4:117959363-117959385 CCTTGACTCTTCCTAGTTTCTGG - Intergenic
979312418 4:119219309-119219331 CCTTGCCCCTTCCTAACTTCTGG + Intronic
979598289 4:122558119-122558141 CCTGGCCTCTCCATAGCATCAGG - Intergenic
979711235 4:123781866-123781888 TCTTGCCTCTCCCAACCTTCTGG - Intergenic
979863060 4:125718500-125718522 GCTTGCCTCCTCCTAGCTTCTGG + Intergenic
980135275 4:128852804-128852826 CCTTGCCTCTTCGTAGCTTATGG + Intronic
980175656 4:129340964-129340986 CCTTGCCTCTTCCTGCCTTCTGG + Intergenic
980238900 4:130147408-130147430 CTTTGCTTCTCTCTAAATTCTGG - Intergenic
980738070 4:136917107-136917129 CAATTCCTCTCTCTAGCTTCTGG + Intergenic
981102853 4:140849603-140849625 CCGTGCCTCTCCCTAGCTTCTGG + Intergenic
981249827 4:142586393-142586415 CTTTGTCTCTCTCTTGCCTCTGG - Intronic
981279101 4:142936532-142936554 CCCTCCCTCTCTTTAGCTCCAGG + Intergenic
981342204 4:143634561-143634583 CCTTTCCTCCATCTTGCTTCTGG - Intronic
981521589 4:145668060-145668082 CTTTGCCTCTTCCTAGTTTCTGG - Intergenic
982307150 4:153944537-153944559 CTTTGCCTCTTTCTAATTTCTGG + Intergenic
982372939 4:154654368-154654390 CCTTGCCCCTTCCCAGCTTCTGG - Intronic
982524271 4:156457497-156457519 CCTTGCCTCTTCCTGGATTCTGG - Intergenic
982635195 4:157887135-157887157 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
982659279 4:158187683-158187705 CCTTGCCTTTCCCTAGCTTCTGG - Intergenic
983078472 4:163355172-163355194 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
983141703 4:164157615-164157637 CTTTGTCTCTGTCTAGCATCTGG + Intronic
983380391 4:166984282-166984304 CCTTGGTTCTCACTAGATTCTGG - Intronic
983422971 4:167544018-167544040 TCATGCCTCTCACCAGCTTCTGG + Intergenic
984537038 4:180989497-180989519 CCTTGCCTCTTCCCAGCTGCTGG + Intergenic
985160180 4:187035968-187035990 GCTTGCCTCTCTCAAGCTGATGG + Intergenic
985790420 5:1923942-1923964 CCGTGCCTCACTCTGGCTTCCGG - Intergenic
986209035 5:5652817-5652839 CCAAGCCTCCCTCCAGCTTCGGG + Intergenic
986243731 5:5985514-5985536 CCCTGCCTCTCTCTGGTTCCAGG + Intergenic
986327420 5:6686612-6686634 CCTTGCCTCTATCAAGATACAGG - Intergenic
986383818 5:7211415-7211437 CCCTGCCTCTTCCTAGCTCCTGG + Intergenic
986548310 5:8924119-8924141 CCTTTCCAGGCTCTAGCTTCTGG + Intergenic
986620101 5:9663939-9663961 CCATGCCTCTGCCTAGCTTCTGG - Intronic
986718638 5:10542307-10542329 CCTTGCCTCTCAGCAGCTCCAGG - Intergenic
986790485 5:11154798-11154820 CCCTGCCTCTTCCTAGCTGCTGG + Intronic
986849413 5:11793620-11793642 CCAGGCCTCTCTCCAGCTTCTGG - Intronic
987549576 5:19361198-19361220 CCCTGCCTCTCCCCAGCTTCTGG + Intergenic
987626525 5:20407803-20407825 CCTTTCCTCTCTTTTTCTTCTGG - Intronic
988355829 5:30172897-30172919 CCTTGCCTGTTCCTAGCTTCGGG + Intergenic
988593563 5:32570007-32570029 CCTTGCCTTTTTTTAACTTCTGG - Intronic
988594122 5:32575359-32575381 CCTTGCCTCTGCCTAGTTTCTGG + Intronic
988801382 5:34699393-34699415 CCGTGTCTCTCCCCAGCTTCTGG + Intronic
988802559 5:34710243-34710265 CCTTGCTTATTCCTAGCTTCTGG + Intronic
989268438 5:39504244-39504266 CCATGTCTCTCTCTAGCTTCTGG + Intergenic
989344655 5:40416421-40416443 TCCTGCCTCTTTCTAGTTTCTGG - Intergenic
989962557 5:50433861-50433883 CCTTGCCTCTGCCTAGCATCTGG + Intronic
990314382 5:54570251-54570273 CCTTGGCTCTGCCTACCTTCTGG - Intergenic
990604326 5:57393891-57393913 TCTTGCCTTTTCCTAGCTTCTGG - Intergenic
991104485 5:62828899-62828921 ATTTTCCTCTCTCTGGCTTCTGG - Intergenic
991959924 5:72034385-72034407 GCTTGCGTCTCTCTATCTTAAGG + Intergenic
992013081 5:72550036-72550058 CCTATGCTCTGTCTAGCTTCTGG - Intergenic
992263316 5:74992324-74992346 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
992475309 5:77096334-77096356 CCTTACCATTCCCTAGCTTCTGG + Intergenic
992494742 5:77281492-77281514 TCTTGCCTCTTCCCAGCTTCTGG + Intronic
992887055 5:81169429-81169451 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
993106468 5:83606125-83606147 CGTTGCCTCTTCCTAGCTTCTGG - Intergenic
993210390 5:84942476-84942498 CCTTTCTTTTCTCTAACTTCTGG + Intergenic
993240167 5:85372996-85373018 CTTTGCCTCTTCCTAGTTTCCGG + Intergenic
993363458 5:87006040-87006062 TCTTCCTTCTCTCTAGCTTTTGG - Intergenic
993567164 5:89490051-89490073 CCTTGGCTCTTTCTAGCTTCTGG - Intergenic
993686444 5:90943681-90943703 CCTGGCCTCCTTCTAGCTGCTGG + Intronic
994068385 5:95569587-95569609 CCTTGCCTCTTCCTAACTTATGG - Intronic
994376362 5:99019390-99019412 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
995178063 5:109201432-109201454 CCTTCCCCATCTCTAGCTCCTGG - Intergenic
995269014 5:110199763-110199785 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
996272817 5:121628906-121628928 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
996399016 5:123039710-123039732 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
996405204 5:123097439-123097461 CTCTGCCACTTTCTAGCTTCTGG + Intronic
996406646 5:123111812-123111834 CCTGGCCTCTCTTCTGCTTCAGG + Intronic
996424232 5:123295160-123295182 CCTTCCTACTCTCTACCTTCTGG - Intergenic
996506589 5:124275109-124275131 CCTTCCCTCTTTGTAGCTTCTGG + Intergenic
997751152 5:136347084-136347106 CCTTGTCTCTTCCTAGTTTCTGG - Intronic
998748633 5:145291446-145291468 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
999105701 5:149069071-149069093 CCTTGTCTTTTTCTAGTTTCTGG - Intergenic
999632278 5:153583411-153583433 CCTTGACTCTTCCTAGCTTCTGG + Intronic
999755173 5:154658808-154658830 CCCCGCCTCTCTCCAACTTCAGG + Intergenic
999893919 5:156008252-156008274 ACTTTCCTCTTTCTAGCTTCTGG + Intronic
999977848 5:156929615-156929637 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
999980619 5:156954409-156954431 GCTTACCTCTCTGTAGATTCAGG + Exonic
1000209441 5:159096749-159096771 GCTTGCCTCTCTCTAGCTCTGGG + Intronic
1000955968 5:167543732-167543754 CCTTGCCCCTTTCTAGCTTACGG + Intronic
1000991296 5:167914730-167914752 CCTTGTCTCTCCCTAGCTTCTGG + Intronic
1000997350 5:167973058-167973080 CCTTGCCTCTATCTACCTAATGG + Intronic
1001243987 5:170092080-170092102 CCTTGCCTCCTCCTGGCTTCTGG + Intergenic
1002183405 5:177442905-177442927 GCCTGCCTCTTTCTTGCTTCCGG + Intergenic
1003304519 6:4914276-4914298 CCTGCCCTCTCTCTGGCCTCTGG - Intronic
1003495906 6:6663031-6663053 TCCTGCCTCTCTCCTGCTTCTGG + Intergenic
1003667186 6:8122228-8122250 CCTTTCCTTCCTCTAGCTTCTGG + Intergenic
1003677875 6:8223429-8223451 CCATGCCTCTGCCAAGCTTCTGG - Intergenic
1003866974 6:10372200-10372222 CCTTGTCTCTTCCTAACTTCTGG + Intergenic
1004322589 6:14644199-14644221 TCCTGCCTCTCTCTAGGTCCTGG - Intergenic
1004603605 6:17173957-17173979 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1004690832 6:17990701-17990723 CCTTTCCTCCTCCTAGCTTCTGG - Intergenic
1005617123 6:27584371-27584393 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1005682359 6:28219041-28219063 CCCTGCGTCTCTCGAGCTGCTGG + Intergenic
1005810746 6:29513954-29513976 CCTTGCCTCTTCCTAACTTCTGG - Intergenic
1006099411 6:31676831-31676853 CCTTGCCTCCCTCCAGCCACTGG - Exonic
1006313020 6:33274608-33274630 CCTTGCCTCTTCCTGTCTTCTGG + Intronic
1006339153 6:33436938-33436960 CCTTGCCTCTTCCTAGCTTCCGG + Intronic
1006436618 6:34029115-34029137 CCCTGCCTCTCCCTTCCTTCGGG + Intronic
1006719329 6:36139837-36139859 CCTTGGCTCTTTTTAGCTTGTGG + Exonic
1006721915 6:36160490-36160512 CCTTGCCCTTTCCTAGCTTCTGG + Intergenic
1007226111 6:40315902-40315924 CCTCGCCTTTCTCAAGCTACAGG - Intergenic
1007466893 6:42058834-42058856 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1007521674 6:42454788-42454810 CCTTCCTTCTCTGCAGCTTCTGG - Intergenic
1007650209 6:43414714-43414736 CGTTCCCTCTCTCTAGCTCCTGG - Intergenic
1007748063 6:44055285-44055307 CACTGCCTCTCTCTAGCATGGGG - Intergenic
1008111092 6:47495373-47495395 CCATGCCCCTATCTGGCTTCTGG - Intronic
1008244266 6:49150837-49150859 ACATGCCTCTCTATAGCTCCAGG - Intergenic
1008731062 6:54483137-54483159 CCCTGCCTCTTTCTAGCATCTGG - Intergenic
1008770695 6:54975389-54975411 CTTTGCCTCTTCCTGGCTTCTGG - Intergenic
1008960789 6:57263380-57263402 CCTTGCCCCTTCCCAGCTTCTGG + Intergenic
1009824155 6:68845363-68845385 CCATGCCTCTCTCCAGGTTCTGG - Intronic
1010025640 6:71212966-71212988 CCAGGCCTCTCCCTAGCTTCTGG - Intergenic
1010110076 6:72216782-72216804 CGTTTCATCTCTCTGGCTTCAGG + Intronic
1010154921 6:72781261-72781283 CCTAGCCCCTTCCTAGCTTCTGG - Intronic
1010819016 6:80391521-80391543 CGTTGCCTCTTCCTAGTTTCTGG - Intergenic
1010977207 6:82329376-82329398 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1011078267 6:83461410-83461432 CCTTGCCTCTTCCTTGCTTCTGG - Intergenic
1011684109 6:89810569-89810591 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1011709506 6:90037963-90037985 CCTTCCTTCTTCCTAGCTTCTGG - Intronic
1012024693 6:93973642-93973664 CCCTGCCTCTCCCCGGCTTCTGG - Intergenic
1012149244 6:95725450-95725472 CCTTGCCGCTACCTAGTTTCTGG + Intergenic
1012657797 6:101847700-101847722 CCTTACCTCTGGCTAGATTCAGG - Intronic
1013185994 6:107758720-107758742 TCTTGCCTCTTCCTAGCTTCTGG - Intronic
1013610650 6:111791645-111791667 CCTTGCCTATTCCCAGCTTCTGG - Intronic
1013655991 6:112247076-112247098 CTCTGCCTCTGTCTATCTTCAGG - Intronic
1014005754 6:116416024-116416046 CTTTGCCTTTTTCTAGCTTTTGG + Intronic
1014754758 6:125290707-125290729 CCTTGCCTCTTTCTAGCTTTTGG - Intronic
1014772388 6:125471716-125471738 CCATGCCTCTTTGTAACTTCTGG - Intergenic
1014835864 6:126159755-126159777 CCCTGCCTCTTCCTAGCTTTGGG + Intergenic
1015157960 6:130118516-130118538 CCTTTCCACTCTCTAGCTAAAGG + Intronic
1015286620 6:131492564-131492586 TCTTGCCTCTCTATAGCTTCTGG - Intergenic
1015337182 6:132053235-132053257 CCTCGCCTCTTCCTAGCTTCTGG - Intergenic
1015442622 6:133266354-133266376 CTTTGTCTCTCCCCAGCTTCTGG - Intronic
1015859195 6:137657498-137657520 CCTGGTCACTCTCTAGCTTCTGG + Intergenic
1016004647 6:139077139-139077161 CCTTGCCTCTTCCTGGCCTCTGG - Intergenic
1016219722 6:141653741-141653763 TCTTGCCTCTTCCTAGCTGCTGG + Intergenic
1016529439 6:145041730-145041752 CCTCACCTCTTCCTAGCTTCTGG + Intergenic
1017061363 6:150488085-150488107 CCCTGCCTTTTCCTAGCTTCTGG + Intergenic
1017202717 6:151773263-151773285 GCATGCTTCTCTGTAGCTTCTGG - Intronic
1018244330 6:161807582-161807604 TCTTGCCTCTTCCTGGCTTCTGG + Intronic
1018297813 6:162368001-162368023 CCTTCCCTCTCTCCTGCTTCTGG - Intronic
1018491892 6:164302557-164302579 CCTTGCCTCTTCCTAAGTTCCGG - Intergenic
1018730271 6:166644969-166644991 TCATGCCTCTTTCCAGCTTCTGG - Intronic
1018993510 6:168692774-168692796 TCCGGCCTCTCTCTAGCTCCTGG + Intergenic
1019838316 7:3413297-3413319 CCCTGCCCCTCTTTAGCTTCAGG - Intronic
1019938824 7:4273460-4273482 CCTTGCCTCTCTCTGTCTTAGGG + Intergenic
1020110283 7:5443922-5443944 CCAGGCCTCTCTCCAGCCTCTGG - Intronic
1020592615 7:10160512-10160534 CCATGCCTCTCTCCAATTTCTGG + Intergenic
1020596713 7:10215332-10215354 CCTTGCCTTTTTTTAGCTTCTGG + Intergenic
1020847702 7:13307806-13307828 CCCTGCCTCTTCCTAGCTTCAGG - Intergenic
1021336220 7:19405801-19405823 TCTTCCCTCTTTCTAGCTCCTGG + Intergenic
1021503697 7:21357375-21357397 TGTTGCCTCTTTGTAGCTTCTGG - Intergenic
1021593753 7:22293169-22293191 CCAAGTATCTCTCTAGCTTCTGG + Intronic
1022407025 7:30099999-30100021 CCTTACCTCTTCCTAGCTTCCGG + Intronic
1022621175 7:31986201-31986223 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1022621241 7:31986693-31986715 CCTTGCCTCTTCCCAGCATCTGG - Intronic
1022668287 7:32431358-32431380 CCTTTCCTCTCTCAGGCCTCTGG + Intergenic
1022778809 7:33557075-33557097 CCTTTCCTCTCCCTGGCTTCAGG + Intronic
1023639163 7:42240504-42240526 CCTTGCCTCTTACTGGCTTCTGG + Intergenic
1023691253 7:42790250-42790272 CCTTGCCTGCTCCTAGCTTCTGG + Intergenic
1023859618 7:44210316-44210338 CCAGGCCTCTCTCCAGCCTCTGG + Intronic
1024134582 7:46393260-46393282 CTTTCCCTCTTCCTAGCTTCTGG + Intergenic
1024800546 7:53072938-53072960 CCTTGCCTCTCTAGAGTTACAGG - Intergenic
1024972421 7:55082876-55082898 CCTGGCCTCTCCCCAGCCTCTGG + Intronic
1025939297 7:66062405-66062427 CTCTGCCTTTCTCTAGCTTCTGG - Intergenic
1026156800 7:67833556-67833578 TCTTGCCTCCTTCTAGATTCTGG - Intergenic
1026354143 7:69542605-69542627 CCTTCCCTCTGTTTAGCTGCCGG + Intergenic
1026365882 7:69647834-69647856 CTTTGCCTCTTCCTAGCTTCTGG + Intronic
1028035217 7:85972853-85972875 CCTGGCCTCTCCCTTGCTCCTGG - Intergenic
1028369988 7:90080602-90080624 CTTTCCCTCTCTGTAGATTCAGG + Intergenic
1028555143 7:92115491-92115513 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1028948439 7:96607080-96607102 CCTTGCCTCTCTTTATCAGCAGG + Intronic
1029295535 7:99537367-99537389 CCTTGGCTCTTCATAGCTTCTGG - Intergenic
1029602035 7:101571974-101571996 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1030412856 7:109203592-109203614 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1030438090 7:109551643-109551665 CCTTGCCTCCATCTAGCTCCGGG - Intergenic
1030985209 7:116233437-116233459 CCTTGCCTCCCTACAACTTCAGG + Intronic
1031023171 7:116650389-116650411 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
1031096840 7:117430288-117430310 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1031138324 7:117911183-117911205 CCTCTCCTCTCCCTAGCCTCTGG + Intergenic
1031311101 7:120197919-120197941 CCTTTCCTCTTTTTAGCTTCTGG - Intergenic
1031450597 7:121913267-121913289 CCTTGCCTCCCTCAAGCACCTGG - Intronic
1031452313 7:121937284-121937306 CCTTGCCTCTCCCTTGATTCTGG - Intronic
1031478373 7:122249395-122249417 CCTTCCCTTTTCCTAGCTTCTGG - Intergenic
1031699660 7:124907494-124907516 CCTTCCCTTTCCCTAACTTCTGG - Intronic
1032614260 7:133449244-133449266 CCTTGCCTTTTCCTAGCTTCTGG - Intronic
1032726372 7:134593151-134593173 TCTTGCCTCTTCCTAGCATCTGG + Intergenic
1032864929 7:135915659-135915681 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1033261854 7:139850853-139850875 CCTTGCCTCTGTCCATCTCCTGG - Intronic
1033310042 7:140254705-140254727 CCTTGCCCCTTCCTAGCCTCTGG - Intergenic
1033412118 7:141127567-141127589 CCATGCCTCTCTCCAGTTTCTGG - Intronic
1033414445 7:141149756-141149778 CCTTGTCTCTTCCCAGCTTCTGG - Intronic
1033592810 7:142827534-142827556 CCTTGTCTCTCTCCCCCTTCTGG - Intergenic
1033837422 7:145332200-145332222 CCATGCCTCTCTCCTGCTTCTGG + Intergenic
1034295933 7:149972520-149972542 CCCTGCCCCTCTCCAGCCTCTGG + Intergenic
1034345658 7:150383900-150383922 CCTTGCCTCTTTCTGGCCTGTGG + Intronic
1034527831 7:151676952-151676974 CTTTGCCTCGCCCTGGCTTCTGG - Intronic
1034733401 7:153407502-153407524 CCTACACTCTCTCTACCTTCTGG - Intergenic
1034810118 7:154124382-154124404 CCCTGCCCCTCTCCAGCCTCTGG - Intronic
1036083148 8:5580277-5580299 CCTTGCCTCTCCCCAGCGTCTGG - Intergenic
1036504348 8:9341875-9341897 CCATGCCTGTCCCTGGCTTCTGG - Intergenic
1036575838 8:10027076-10027098 TCTTGCCTCTCTCCTACTTCAGG + Intergenic
1036721283 8:11177727-11177749 CCATGCCCCTTCCTAGCTTCTGG - Intronic
1036917313 8:12816595-12816617 CCTTGCCTCCTCCTACCTTCTGG + Intergenic
1037161184 8:15774485-15774507 CCTTGCCTCTTCCTAGCTATTGG - Intergenic
1037381047 8:18285572-18285594 CCATGCCTCTCCCTACCTTCTGG + Intergenic
1037532764 8:19793913-19793935 ACTTGCAGCTCTCTAACTTCAGG - Intergenic
1037676102 8:21051945-21051967 CCTTGCTTCTCCATAGCCTCTGG + Intergenic
1037754943 8:21704575-21704597 GCTAACCTCTCTCTGGCTTCTGG + Intronic
1038009087 8:23459615-23459637 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1038869412 8:31478242-31478264 CATTGCCTCTTTCTAGTTTCTGG + Intergenic
1038892244 8:31738703-31738725 CCTTGCCTCTCCCTGTTTTCTGG + Intronic
1039299599 8:36195115-36195137 CCTGGTTTCTCTCTGGCTTCAGG - Intergenic
1039381907 8:37093317-37093339 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
1039815683 8:41092602-41092624 CCTTGCCTTCCTCTAGGTTCAGG + Intergenic
1040764604 8:50892137-50892159 CTTTGCCTCTTTGCAGCTTCTGG - Intergenic
1041139179 8:54796659-54796681 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
1041786225 8:61637305-61637327 CCTGACCTCACTCCAGCTTCAGG + Intronic
1042029254 8:64456900-64456922 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1042115094 8:65422675-65422697 ACTTGCCTCTTTCTAGCTTTTGG - Intergenic
1042168455 8:65969973-65969995 TCTTGCCTCTTTTCAGCTTCTGG - Intergenic
1042315036 8:67417221-67417243 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1042317581 8:67440184-67440206 CCTTGCCTCTTCCTAGCTTTGGG + Intronic
1042793559 8:72635248-72635270 TGTTGCCTCTGTCTACCTTCAGG - Intronic
1043788497 8:84432809-84432831 TCTTGCCTTTTTTTAGCTTCTGG - Intronic
1043924804 8:86024852-86024874 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1044016336 8:87051996-87052018 CCTTGACCCTATCTAGCTTGTGG - Intronic
1044589437 8:93899446-93899468 CCTTGCCTCTTCCTAGCTGCTGG - Intronic
1044610672 8:94088830-94088852 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1044688958 8:94857619-94857641 CCTTGCGTCTTCCTAGCTTCTGG + Intronic
1044773337 8:95660913-95660935 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1044959308 8:97515002-97515024 CCTTGCCTCTTCCTTGCTTCTGG + Intergenic
1045176920 8:99735529-99735551 CCTTGTCTCTTCCTAGTTTCTGG - Intronic
1045379283 8:101607105-101607127 CCTTCCCTCTATCTCTCTTCCGG + Intronic
1046194319 8:110839005-110839027 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1046355584 8:113081296-113081318 TCTTGGCTCTTCCTAGCTTCTGG + Intronic
1046507939 8:115160139-115160161 CTTTGCCTTTCCCTAGCTTTGGG + Intergenic
1047047740 8:121073687-121073709 CCTTGCCTCTTCCTATCTTCTGG - Intergenic
1047284203 8:123472499-123472521 CCTTGCCTATCCCTAGTTTCTGG + Intergenic
1047388023 8:124427421-124427443 CCTTGCCTCTTCCTAGATTCTGG + Intergenic
1047607748 8:126491506-126491528 CCCTGCCTCTTCCTAGCTTTTGG - Intergenic
1047619796 8:126594781-126594803 CCTTGGTTCTTCCTAGCTTCTGG - Intergenic
1047669361 8:127127786-127127808 CCTTGCCTCTTTTTAGTTTCTGG - Intergenic
1047749613 8:127870318-127870340 CCTTGCCTCTTTCTGGCATCTGG - Intergenic
1047779979 8:128103122-128103144 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
1047909805 8:129515707-129515729 TCTTGCCTCTTCTTAGCTTCTGG + Intergenic
1047941657 8:129832413-129832435 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1047957047 8:129984183-129984205 CCCTGCCTCTCTCTGGCTGCAGG + Intronic
1048007197 8:130428982-130429004 CCTTGCCTCTTCCTGGCTTGTGG + Intronic
1048048353 8:130794114-130794136 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1048176466 8:132156978-132157000 TCTTGCCTCTTCCTAGCTTCAGG - Intronic
1048217920 8:132513706-132513728 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1048299388 8:133240063-133240085 CCATGCCTCTTCCTGGCTTCTGG - Intronic
1048380076 8:133857784-133857806 CCTTATCTCTTCCTAGCTTCTGG + Intergenic
1048395991 8:134014437-134014459 CCAGGCCTCTTTGTAGCTTCTGG - Intergenic
1049157909 8:141078185-141078207 CCCTGCCTCTTCCTAGTTTCTGG + Intergenic
1049431340 8:142566708-142566730 CCCTGCCTCACTCCAGCTGCTGG - Intergenic
1050197794 9:3106707-3106729 CCTGGGCTCTGTCTAGTTTCTGG - Intergenic
1050206585 9:3202790-3202812 CCTTGACTCTTCCTAGCTTTTGG + Intergenic
1050291706 9:4162058-4162080 CCTTGCCCCTTCCCAGCTTCTGG + Intronic
1050532920 9:6606426-6606448 CCTTACCTCTCACTTTCTTCTGG - Intronic
1051686617 9:19664825-19664847 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1051724648 9:20076515-20076537 TCTTGCCTCTTCCCAGCTTCTGG - Intergenic
1051745715 9:20292977-20292999 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1051748358 9:20316981-20317003 CCTTGCCTCTACCTGGCTCCTGG + Intergenic
1052127721 9:24798437-24798459 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
1052361677 9:27567877-27567899 CCTTGCCTCTTCCTGGCTTCTGG - Intronic
1052921338 9:33972509-33972531 CTTTGTCTCTCTCTAACTTCAGG - Intronic
1052978355 9:34428897-34428919 CTTGGCCTCTCTCTTGCTCCAGG - Intronic
1053098005 9:35345927-35345949 CCTTGTATATGTCTAGCTTCTGG + Intronic
1053431426 9:38044123-38044145 CCCTGCCTCTCTCTAGCACAAGG + Intronic
1054741819 9:68813810-68813832 CCTTGCTACTTTTTAGCTTCTGG - Intronic
1054979334 9:71186002-71186024 CTTTGCCTCTTCCTAGCATCTGG + Intronic
1055130553 9:72769549-72769571 CACTGCCTCACTCTAGCCTCGGG - Intronic
1055380235 9:75698747-75698769 CCTTGGCTCTTCCTAGCTTCAGG + Intergenic
1055710456 9:79055228-79055250 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1055751709 9:79513855-79513877 CCTTGCCCCTCTCTTGCTTCTGG - Intergenic
1056047838 9:82737915-82737937 TCTTGCCTCTTGCTAGCATCTGG + Intergenic
1056343573 9:85665347-85665369 CCTTGCTTCTTCCTAGCTTCTGG - Intronic
1056508439 9:87280019-87280041 CCTGCCCTCTCTCCAGGTTCTGG - Intergenic
1056658339 9:88526853-88526875 GCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1056781559 9:89554816-89554838 CCTCGCCTCCCTGCAGCTTCTGG - Intergenic
1056879702 9:90379517-90379539 CCTTGCCTCCTCCTAGCTTCTGG - Intergenic
1057055612 9:91958348-91958370 CCAGGCCTCTCTCCAGCTTTTGG - Intergenic
1057087662 9:92226667-92226689 TTTTGCCTCTTCCTAGCTTCTGG + Intronic
1057183705 9:93043873-93043895 CCTTGCCTCTTCCTAGTCTCTGG - Intergenic
1057540280 9:95961381-95961403 CCTTGCCTCTTTCTAGCTTCTGG - Intronic
1057991051 9:99770010-99770032 CCTTGCCTCTTCCTAGCGTCTGG + Intergenic
1058164129 9:101601653-101601675 GCTTGCCTCTTCCTAGCTCCTGG + Intronic
1058553372 9:106139516-106139538 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1058640039 9:107074878-107074900 CTTTGCCTCTTCCTTGCTTCTGG + Intergenic
1058660825 9:107267031-107267053 CCTTACCTCTTTCTGACTTCTGG + Intergenic
1058662101 9:107275949-107275971 CCTCATCTCTTTCTAGCTTCTGG - Intergenic
1058766021 9:108183487-108183509 CCTTGCCCCTTTCGAGCCTCTGG + Intergenic
1058922755 9:109632864-109632886 CCTTGCCTCTCTCTAATGTGTGG + Intergenic
1059199468 9:112400740-112400762 CCTTGCTTCTTCCCAGCTTCTGG + Intronic
1059263588 9:113004187-113004209 CTTTGCTTCTCCCTAGCTTCAGG - Intergenic
1059402569 9:114079484-114079506 CCTTGCCTTTTGCTAGCTTTTGG - Intergenic
1059829685 9:118081208-118081230 CCTTGCCTTTTCATAGCTTCTGG - Intergenic
1059963778 9:119593365-119593387 CCTTGCCTCTTCCTAGATTCTGG - Intergenic
1060007984 9:120017239-120017261 CCTTGCCTCTCCCTAGCTTCCGG + Intergenic
1060259434 9:122061047-122061069 CCATGCCTCTTCCTGGCTTCTGG + Intronic
1060280258 9:122210984-122211006 CCATGCCTCACTCTAGGTGCTGG - Intronic
1060518766 9:124282213-124282235 CCGTGCCTTTTTCTGGCTTCTGG + Intronic
1060923276 9:127437669-127437691 CCTTGCCTCTTTCTAGTTTCCGG + Intronic
1061247819 9:129410125-129410147 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1061351009 9:130064879-130064901 CCTTGCCTCTTTCAAGCTCCTGG - Intronic
1061486684 9:130923873-130923895 CCTTGCCTCCCTCAGGCTCCCGG - Exonic
1061806570 9:133140527-133140549 CCTTCCCTCTTTCTAGGTTAGGG - Intronic
1062283703 9:135763567-135763589 CCATGCCTCTCTCCAGCTTCTGG + Intronic
1186317648 X:8387991-8388013 CCTTCACTCTCTCTTGCTTCCGG + Intergenic
1186399422 X:9243003-9243025 CCATGCCTCTCTCCAGCTTCTGG + Intergenic
1186902175 X:14068461-14068483 CCTGGTCTCTTTCTAGCTTCTGG + Intergenic
1186961713 X:14743788-14743810 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
1187117669 X:16369880-16369902 CCTTGCGTCTTCCTAGCTTCTGG + Intergenic
1187548224 X:20274392-20274414 CCTTGCCACTTCCTAGCTTCTGG - Intergenic
1187566392 X:20453903-20453925 TCTTGCCTCTTCCTAGTTTCTGG + Intergenic
1187865610 X:23720602-23720624 CCTTGTCTGTTTCTTGCTTCTGG - Intronic
1187928336 X:24271028-24271050 CTTTGCTTCTTTCTAGCTTCTGG + Intergenic
1188383827 X:29531744-29531766 CCTTGCCTCTTCTTAACTTCTGG + Intronic
1188402011 X:29756999-29757021 CCTTGCCTCTTCTTAGCTTCTGG - Intronic
1189136733 X:38558413-38558435 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1189183094 X:39022166-39022188 CATTGCCTCTCTCTAGTTCTCGG + Intergenic
1189360777 X:40349207-40349229 CCTTGCCTCTTTCTAGTTTCTGG + Intergenic
1189868234 X:45353696-45353718 CCTTACCTCTTCCTAGCCTCTGG - Intergenic
1190434118 X:50406676-50406698 CTTTGCCTCCTCCTAGCTTCTGG - Intronic
1190461823 X:50684348-50684370 CCTTGATTCTTCCTAGCTTCTGG - Intronic
1190529074 X:51356805-51356827 CTTTCCTTTTCTCTAGCTTCAGG - Intergenic
1191123772 X:56932832-56932854 CCTTTCCAGGCTCTAGCTTCTGG + Intergenic
1191714715 X:64186507-64186529 CCATGCCTCCCTCTAGCAACTGG + Exonic
1193686497 X:84582734-84582756 CTTTGCCCCTTTCTAGCTTCTGG + Intergenic
1194562372 X:95438437-95438459 CCTTGCCTCTGCCTAGTTTCTGG - Intergenic
1195404195 X:104494773-104494795 ACTTCCCTCTCCCTAGCTCCTGG + Intergenic
1195525118 X:105879011-105879033 CCTTGTCTCTTCCTGGCTTCTGG + Intronic
1196004963 X:110826127-110826149 CCTTGCCTCTTCCTAGCCTCCGG - Intergenic
1196265017 X:113633377-113633399 CCTTGCCTCTTTCTGATTTCTGG - Intergenic
1196711536 X:118768786-118768808 CTTTGCCTCTTCCTAGCTTCTGG - Intronic
1196740336 X:119019520-119019542 CCTTTCCTGTTTCTAGCTACAGG - Intergenic
1196963842 X:121033663-121033685 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
1197683441 X:129411638-129411660 CTTTGCCTCTCCTTAGCTTCTGG - Intergenic
1197820746 X:130538605-130538627 CCTTGCCCGTTTCTAGCTTCTGG + Intergenic
1197983283 X:132241138-132241160 CCTTGCCTCTTGCCTGCTTCAGG - Intergenic
1198395718 X:136217252-136217274 GCTTGCCTTTCTCTAGCCACTGG - Exonic
1198419811 X:136459868-136459890 CCTTGCCTCTTTCTAACCTTTGG - Intergenic
1198470298 X:136939990-136940012 CAATGCCTCCTTCTAGCTTCTGG + Intergenic
1198659274 X:138949344-138949366 CCTTGCCTCTTCTTAGCTTCTGG + Intronic
1198852978 X:140985626-140985648 CCTTGTCTCTTCTTAGCTTCTGG + Intergenic
1198882634 X:141297736-141297758 CCTAGCCTCTTCCTAGCCTCTGG - Intergenic
1199118460 X:144021095-144021117 CCTTGCCTCTCCTTAGCTTGCGG + Intergenic
1199133296 X:144220155-144220177 CTTTGTCTCTATCTATCTTCAGG + Intergenic
1199480717 X:148295965-148295987 CCTTCCCTCTCCTTGGCTTCTGG - Intergenic
1199593723 X:149490831-149490853 TCTTGCCTCTCCCTAGCTGGTGG + Intronic
1199726095 X:150582717-150582739 CCTTGCCTCTCCCTAGCTTCTGG - Intronic
1199791299 X:151157650-151157672 CCTTGCCTCTCCCTAGCTACTGG + Intergenic
1199903352 X:152199454-152199476 CCTTGCCTCTCCCTAGTTTCTGG - Intronic
1200123141 X:153800665-153800687 CTTGGCCTCCCTCTAGCTGCTGG - Intergenic
1200486288 Y:3772691-3772713 CCTTCCTTCTCTTTACCTTCTGG + Intergenic