ID: 922919300

View in Genome Browser
Species Human (GRCh38)
Location 1:229288085-229288107
Sequence CAAACACCTGTAGCTTGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922919298_922919300 16 Left 922919298 1:229288046-229288068 CCAAATCATTTCCATAGAACACT 0: 1
1: 0
2: 0
3: 19
4: 198
Right 922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG 0: 1
1: 0
2: 0
3: 4
4: 108
922919297_922919300 17 Left 922919297 1:229288045-229288067 CCCAAATCATTTCCATAGAACAC 0: 1
1: 0
2: 1
3: 17
4: 250
Right 922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG 0: 1
1: 0
2: 0
3: 4
4: 108
922919296_922919300 30 Left 922919296 1:229288032-229288054 CCAACAAATTCATCCCAAATCAT 0: 1
1: 0
2: 1
3: 28
4: 235
Right 922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG 0: 1
1: 0
2: 0
3: 4
4: 108
922919299_922919300 5 Left 922919299 1:229288057-229288079 CCATAGAACACTACGATTAATGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922919300 Original CRISPR CAAACACCTGTAGCTTGCAT AGG Intronic
901069328 1:6509387-6509409 GAAACAGCTGTAGTTTGCAGAGG - Intronic
910986442 1:93009400-93009422 GCAACACCTGCAGCTGGCATTGG - Intergenic
913440954 1:118897156-118897178 CAGACACAGGAAGCTTGCATGGG - Intronic
915781708 1:158559097-158559119 GCAACACCTTTAGCTGGCATTGG + Intergenic
916346417 1:163796840-163796862 GAAACACCTGTGGCATGCAATGG + Intergenic
917043213 1:170829382-170829404 AAAACACCTGTAGCATGGTTGGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
921011581 1:211147035-211147057 CAAATTCATTTAGCTTGCATAGG + Intergenic
922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG + Intronic
1064223106 10:13458676-13458698 CAAACTCCTAGAGCTTGCAAAGG + Intronic
1064244146 10:13656234-13656256 CCCACAGCTGTAGCTTGCAAAGG - Intronic
1067984932 10:51132619-51132641 GAAACACTTGTAGATTGCATAGG - Intronic
1068316657 10:55352959-55352981 GCAACACCTGCAGCTGGCATTGG + Intronic
1071869842 10:89781596-89781618 CAGAGTCCTGTAGCTGGCATTGG + Intergenic
1072736033 10:97880307-97880329 CCGGCACCTGTAGCTTCCATAGG + Exonic
1072844642 10:98816230-98816252 CAAAAACCTGTAGATTGTAATGG - Intronic
1073179520 10:101575285-101575307 CCAACAGCAGTAACTTGCATGGG + Intronic
1077902798 11:6503259-6503281 CAAACACATGTTTCTTCCATTGG - Intronic
1078378320 11:10815748-10815770 TATACATCTATAGCTTGCATGGG - Intronic
1078739175 11:14050708-14050730 CAAACACCAGTGGCCTGCAGTGG - Intronic
1080956686 11:37105392-37105414 CAAATACCTGTAAACTGCATAGG + Intergenic
1081595158 11:44453907-44453929 CAAACACCCATTGCTTTCATGGG - Intergenic
1084092130 11:66885708-66885730 CAAACACCAGAAGCTGGCAGTGG + Intronic
1085549356 11:77353669-77353691 CCAACCCCTGTAGCTGGCAAGGG + Intronic
1086839297 11:91665826-91665848 AAAACACCAGAAGCTTGCCTAGG + Intergenic
1087302550 11:96452777-96452799 CTAACAAATGTAGCTTGCCTTGG + Intronic
1092436789 12:8454339-8454361 AAAACACTTGTAGGTTGCCTTGG + Intergenic
1096907631 12:54949586-54949608 CTAACAGCTGTAGTTTGCTTTGG - Intronic
1104334239 12:127878439-127878461 AAAAAACCTGTGGCTTTCATTGG - Intergenic
1104640860 12:130465970-130465992 CAAACTCCTGAGGCTTGAATGGG + Intronic
1106081725 13:26506148-26506170 AAAACAGCTATAGCATGCATGGG - Intergenic
1106552033 13:30780473-30780495 CAGACACCTGTAGCTTTCCCAGG - Intergenic
1113654253 13:112058124-112058146 CAAACACCTGTTTCCTGCAAGGG - Intergenic
1120289683 14:82551810-82551832 CCAACACCTGTGGTTTGGATAGG - Intergenic
1133901342 16:9978185-9978207 CACACAACTCTAACTTGCATTGG - Intronic
1135158852 16:20075637-20075659 CAAAAACCTATAGATTGGATTGG + Intergenic
1137071530 16:35908553-35908575 CAAGCTTCTGAAGCTTGCATTGG + Intergenic
1137447252 16:48539407-48539429 CCCAGACCTGCAGCTTGCATGGG - Exonic
1138947178 16:61865436-61865458 CAAACATCTGTAATGTGCATTGG + Intronic
1139345271 16:66298861-66298883 CACACACCTGTAGACTGCCTGGG - Intergenic
1141035593 16:80622790-80622812 CAAACACAGTTAGCTTTCATGGG - Intronic
1149322602 17:55496877-55496899 CAAACACCTTTAGGTTGAAAGGG - Intergenic
1151434105 17:74083494-74083516 CATACACCTGTAGCTTTCAAGGG - Intergenic
1152641081 17:81449533-81449555 CACACGCCTGTAGCCTGCAAGGG + Intronic
1152662863 17:81551028-81551050 CAAACAGCTGCATCTTCCATCGG + Exonic
1154385437 18:13887979-13888001 CCAACACCTGTGGCCAGCATGGG + Intronic
1155783781 18:29873686-29873708 CATACACCTGTAGTTTTCAGGGG - Intergenic
1155826539 18:30451147-30451169 CAATCAGCTGTAGCTTGCTGAGG + Intergenic
1156902096 18:42311697-42311719 CAAACTCCTCTAGATGGCATTGG + Intergenic
1158440273 18:57469025-57469047 CAAACACCTGTAGGTTTCTCAGG + Intronic
1158770875 18:60515455-60515477 CAAACAACTGTTGCTTGAATCGG + Intergenic
1158916098 18:62131548-62131570 CAAACACCTGAAGCTAAAATTGG - Intronic
1158956670 18:62546720-62546742 CAAACAGCTGAAGCTTCCAGAGG - Intronic
1160996478 19:1884477-1884499 AGAACACCTCTAGCTTGCAGAGG - Intronic
1161029249 19:2050399-2050421 CAACCAGCTGGAGCTTGCAGGGG + Intronic
926327878 2:11800653-11800675 CAGAAAGCTGTAGGTTGCATAGG + Intronic
926598486 2:14816141-14816163 CAAACTCCTTTAGCTTACACAGG + Intergenic
928638377 2:33271406-33271428 TAAACACCAGTAACTTGCAAAGG + Intronic
932539042 2:72631858-72631880 CAAACACATGTACTTTGCAGGGG + Intronic
936915958 2:117639256-117639278 CAAACAGCTGTAGGTTTCTTTGG + Intergenic
938019961 2:127898269-127898291 AAAAGAAATGTAGCTTGCATCGG + Intergenic
940346548 2:152634782-152634804 GCAACGCCTGTAGCTAGCATTGG - Intronic
945210409 2:207376577-207376599 CAAATACCTGATGCATGCATGGG - Intergenic
1175206180 20:57313285-57313307 CAGACACCTGTGACTTGCTTTGG + Intergenic
1175206496 20:57315758-57315780 CAGACACCTGTGACTTGCTTTGG + Intergenic
1182253010 22:29016812-29016834 CAAGCACCTGTAGCATGCTAGGG + Intronic
1182495817 22:30706740-30706762 GAAACACATGTGGCTTGCAAAGG - Intronic
949850584 3:8416510-8416532 CAAACCCCTCTAGCTTGGAAAGG + Intergenic
953872472 3:46639256-46639278 CAAACACATAGAGCTTGCAGAGG - Intergenic
955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG + Intronic
956480814 3:69672296-69672318 CCACCATCAGTAGCTTGCATGGG - Intergenic
956782871 3:72618211-72618233 CACACACCTGTCCCTTGCCTGGG + Intergenic
965787892 3:172355645-172355667 CAAACACCTGTATTTTGAAAAGG - Intronic
970493291 4:16598410-16598432 CAAACAGCACTAACTTGCATGGG + Intronic
976104947 4:81606579-81606601 AAAATAACTGTACCTTGCATCGG + Intronic
976122868 4:81801997-81802019 CAAAGAACTGTATCTGGCATAGG - Intronic
977400824 4:96529699-96529721 GTAACACCTGCAGCTGGCATTGG - Intergenic
979219704 4:118208564-118208586 AAAACAGATGTGGCTTGCATAGG + Intronic
979814181 4:125078891-125078913 CAAACACCTGTACCTGGTGTTGG - Intergenic
980371992 4:131886747-131886769 AAAATGCCTGTAGCTTGAATCGG + Intergenic
981881974 4:149625134-149625156 CAAACCCCAGAAGCTTGCTTGGG + Intergenic
984727111 4:183032038-183032060 CAAAGACGTGAAGCTTGCAGTGG + Intergenic
985379205 4:189374437-189374459 CAATTTCCTGTAGCTTTCATGGG + Intergenic
992083948 5:73261159-73261181 CAAACATCTGAAGCTTTGATGGG + Intergenic
997446946 5:133947264-133947286 CAAACACATGATGCTTGGATTGG - Intergenic
999863393 5:155673843-155673865 GCAACACCTGTAGCCAGCATTGG - Intergenic
1000784811 5:165529853-165529875 AAAATATCTGTAGCTGGCATTGG + Intergenic
1005830775 6:29669667-29669689 AAAACATCTGTGGCTTCCATTGG + Intronic
1012047280 6:94293872-94293894 CAAACATCTCTACCTTGCAGGGG - Intergenic
1016356404 6:143223387-143223409 TAAACACCTGTAGCCTTCACAGG - Intronic
1023493458 7:40768816-40768838 CAAACACCAGTACCCTGTATTGG + Intronic
1024383829 7:48728316-48728338 GTAACACCTGTAGCCAGCATTGG - Intergenic
1030823303 7:114122224-114122246 CAAACAACTGAAGCATTCATGGG - Intronic
1041213148 8:55572869-55572891 ACAACACCTGCAGCTGGCATTGG - Intergenic
1043918381 8:85951591-85951613 CAAACACATGAAGCCTCCATTGG + Intergenic
1046992025 8:120468681-120468703 GCAACACCTGTAGCCGGCATTGG - Intronic
1048188875 8:132270083-132270105 TAAACACCTGCAGCTTCCCTAGG + Intronic
1048421996 8:134285978-134286000 CAAGGAGCTGTGGCTTGCATGGG - Intergenic
1048936341 8:139360548-139360570 CAAAGACCTTTAGCTTGAAGAGG + Intergenic
1053636697 9:40014297-40014319 AAAATGCCTGTAGCTTGAATCGG + Intergenic
1053769296 9:41450318-41450340 AAAATGCCTGTAGCTTGAATCGG - Intergenic
1054317562 9:63611373-63611395 AAAATGCCTGTAGCTTGAATCGG + Intergenic
1054547963 9:66361821-66361843 AAAATGCCTGTAGCTTGAATCGG - Intergenic
1054923328 9:70563496-70563518 CAATCATCTGTAGCCTGAATTGG - Intronic
1057224239 9:93279747-93279769 CAAACATCTGTAGGTTGTGTGGG - Intronic
1058547480 9:106076342-106076364 GCAACACGTGTAGCTTGCATGGG - Intergenic
1187544230 X:20231860-20231882 CAAACACCAGAAGCTGGAATAGG + Intronic
1193024215 X:76827003-76827025 GCAACACCTGCAGCTGGCATTGG - Intergenic
1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG + Intergenic
1198282394 X:135154872-135154894 TAACCACCTGTAGCTTTCAGAGG - Intergenic
1198288565 X:135217650-135217672 TAACCACCTGTAGCTTTCAGAGG + Intergenic
1199198716 X:145062083-145062105 GCAACACCTGCAGCTGGCATTGG + Intergenic
1201965579 Y:19730507-19730529 CAATCACCTATAGCCTCCATTGG - Intronic