ID: 922922012

View in Genome Browser
Species Human (GRCh38)
Location 1:229313410-229313432
Sequence CCAGACCAGCAGGCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922922003_922922012 28 Left 922922003 1:229313359-229313381 CCAAAAATTGCATGCAGAGTTTT No data
Right 922922012 1:229313410-229313432 CCAGACCAGCAGGCAGTGGAGGG No data
922922004_922922012 -10 Left 922922004 1:229313397-229313419 CCAGAGCCCCATTCCAGACCAGC No data
Right 922922012 1:229313410-229313432 CCAGACCAGCAGGCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922922012 Original CRISPR CCAGACCAGCAGGCAGTGGA GGG Intergenic
No off target data available for this crispr