ID: 922923856

View in Genome Browser
Species Human (GRCh38)
Location 1:229331048-229331070
Sequence CTTTTCCAGGTCATCCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922923856_922923858 5 Left 922923856 1:229331048-229331070 CCACTAAGGATGACCTGGAAAAG 0: 1
1: 0
2: 2
3: 15
4: 144
Right 922923858 1:229331076-229331098 TGAAATTCAAAAGTGACCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 171
922923856_922923862 24 Left 922923856 1:229331048-229331070 CCACTAAGGATGACCTGGAAAAG 0: 1
1: 0
2: 2
3: 15
4: 144
Right 922923862 1:229331095-229331117 CAGGCTAACAAATGTCTATCAGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922923856 Original CRISPR CTTTTCCAGGTCATCCTTAG TGG (reversed) Intronic
900685016 1:3942777-3942799 CTTTTCAAGATCTGCCTTAGTGG + Intergenic
901909597 1:12445519-12445541 CTTTCCCAGGTCACCCTTTGTGG + Intronic
905334013 1:37231847-37231869 AGTTTGCAGGTCCTCCTTAGTGG - Intergenic
907063974 1:51461006-51461028 CTCTTTTAGTTCATCCTTAGAGG - Intronic
907688862 1:56642658-56642680 ATTTACCAGGTCATCTTTAGGGG + Intronic
908840195 1:68272417-68272439 CTTTTCAGGGTCAGCCTAAGAGG - Intergenic
911276661 1:95868647-95868669 CTTTTCCAGGTCTTCATTCTAGG + Intergenic
911409283 1:97482310-97482332 TTTTAGCAGTTCATCCTTAGTGG - Intronic
911724819 1:101232318-101232340 CTTTTCCAGTCCATCATTGGTGG - Intergenic
911795597 1:102071778-102071800 GTTTTCCAGCTCATGCTTATAGG + Intergenic
915548806 1:156619754-156619776 CTCTTCCAGGTCATCATTCCTGG + Intronic
915842178 1:159223031-159223053 ATTATCCAGGTCTTCCTTACTGG + Intergenic
915917764 1:159951362-159951384 CTTTTTCAGGCCCTCCTTTGGGG - Intergenic
917615178 1:176735444-176735466 AACTTCCAGGTCATCCTTTGTGG - Intronic
921090707 1:211839597-211839619 CTTCTCTAGGGTATCCTTAGAGG + Intergenic
921387307 1:214583040-214583062 ATTTTCCATGTTATTCTTAGGGG + Intergenic
922923856 1:229331048-229331070 CTTTTCCAGGTCATCCTTAGTGG - Intronic
923483512 1:234406872-234406894 CATTTCCATGTGAGCCTTAGGGG - Intronic
1063777339 10:9279029-9279051 CTTTTTCAGGTCATACTCAGAGG - Intergenic
1067820819 10:49528467-49528489 CATCTCCAGGCCATCCTTGGAGG - Exonic
1068148564 10:53102152-53102174 CTTTTCCAGGACATTTTTAAGGG + Intergenic
1070100500 10:73381643-73381665 CTTTTCCAGGGCATGAGTAGAGG - Intronic
1072802759 10:98404881-98404903 GTTTCCCAGGTCATACTTTGTGG + Intronic
1073319450 10:102605685-102605707 CTTTTCCAGTTCTGCCTTAAAGG + Intronic
1073374173 10:103018630-103018652 ATTTTCCTGGTTCTCCTTAGTGG - Intronic
1075012653 10:118887818-118887840 ATCCTCCAGGACATCCTTAGAGG + Intergenic
1076189709 10:128474410-128474432 CTTTCCCAGGTCACCCTTATAGG + Intergenic
1078657496 11:13255393-13255415 CTTCTCCACTTCATCCTTTGCGG - Intergenic
1079162562 11:18008602-18008624 CTTTTCCTGGCCATTCTAAGAGG - Intronic
1081438069 11:43050076-43050098 CTATTTCATGTCATCCTTAATGG + Intergenic
1082042687 11:47699316-47699338 CTTTTCCAGGCCAACATGAGTGG - Intronic
1082152640 11:48761655-48761677 CCTTTCCAGGTCAAGCTCAGAGG - Intergenic
1086418519 11:86614169-86614191 CTTCTCCAGTTCTTTCTTAGAGG - Intronic
1087004109 11:93452122-93452144 CTTTTCCAACTCATCCTTTATGG - Intergenic
1089865484 11:121627750-121627772 CTTACCCAGGTCATCCCCAGAGG - Exonic
1091278066 11:134365637-134365659 GCCTTCAAGGTCATCCTTAGAGG + Intronic
1091703264 12:2677797-2677819 CTTGTCCAGCTCCTCCTCAGCGG - Exonic
1092256797 12:6930419-6930441 CTTTTCCTGTTCTTACTTAGGGG + Intronic
1093382919 12:18517133-18517155 CTTTTGCAGGTGATCTTTGGTGG + Intronic
1095233630 12:39771523-39771545 CTTCTCCAGCTGAGCCTTAGAGG + Intronic
1095273724 12:40254158-40254180 CTTTTGCAGGACATTTTTAGAGG + Intronic
1097278309 12:57827985-57828007 GTTTTCCATGCCCTCCTTAGGGG + Intronic
1104345179 12:127990109-127990131 CTTTGCTAGCTCCTCCTTAGGGG - Intergenic
1110693486 13:78459632-78459654 CTTTTCCAGGTCAAGCTCAGAGG - Intergenic
1113225286 13:108152872-108152894 CTGTTCTTGGTCATTCTTAGGGG + Intergenic
1113286544 13:108855462-108855484 CGTTGCCAGGTCATCGTTTGGGG - Exonic
1113811642 13:113146337-113146359 CTTTTCCTGCTCATCCTCGGTGG - Intronic
1114353224 14:21877849-21877871 CTTTTCTAGGTCATCCTTGGGGG + Intergenic
1114422770 14:22598434-22598456 CTTTTCCAGGTCGGCCTCCGGGG + Intronic
1117595391 14:57321840-57321862 CCTTTCCAGGTCATCTTGATTGG - Intergenic
1122907907 14:104810650-104810672 CTTTCCCAGGTCATCTCCAGAGG + Intergenic
1128376038 15:67076727-67076749 TTTTTCCAGATCATGCTCAGAGG + Intronic
1128521727 15:68379739-68379761 TTTTTCCAAGTCATGCTCAGAGG + Intronic
1129943476 15:79518907-79518929 CTTTTCCAGGTGCTTCCTAGAGG + Intergenic
1130914250 15:88292158-88292180 CTTTCCCAGATTATCCTTGGGGG + Intergenic
1130972921 15:88748481-88748503 CTTTTCTATGTCCTCTTTAGCGG + Intergenic
1132306807 15:100820865-100820887 CCTTTCCAGGTTATCTTTGGTGG + Intergenic
1134626141 16:15724266-15724288 CTTTTCCAGTTTATCATAAGCGG + Exonic
1136251000 16:29005011-29005033 CCTTTCGAGGACATCCTTGGAGG + Intergenic
1136984772 16:35090518-35090540 CTTTTCCTGCTCATCCTGAGGGG - Intergenic
1137243644 16:46683568-46683590 CTTTTCCTGCTCATCCTGAGGGG + Exonic
1139195657 16:64915744-64915766 TTATTCCAGGCCATCATTAGAGG - Intergenic
1140049822 16:71470500-71470522 CATTGCCAGGTCCTCCTTACAGG + Intronic
1144396180 17:14845414-14845436 CTTACCCAGGTCATGATTAGTGG + Intergenic
1148638588 17:49168109-49168131 CTTTACCACATCACCCTTAGAGG + Intronic
1149439544 17:56663143-56663165 CTATTTCATTTCATCCTTAGAGG + Intergenic
1149970217 17:61210515-61210537 CTTTCCCAGCTCATGCCTAGTGG + Intronic
1152118298 17:78402239-78402261 CTGTCCCAGGTCATCCTTGCTGG - Intronic
1152691718 17:81721082-81721104 CTTGGCCCGGTCCTCCTTAGGGG - Intergenic
1155348865 18:24886241-24886263 CTTTACCTGGTCAGCCTTGGTGG - Intergenic
1156499747 18:37550157-37550179 CTCTTCCAGCTCCTCCTGAGAGG - Intronic
1159287510 18:66373370-66373392 CTTTTCCAGCTCATTCACAGTGG - Intergenic
1162234572 19:9297894-9297916 CTTATCCAGGGCATCTTTATGGG - Exonic
1163667050 19:18608077-18608099 CTTTTCCAGGAGTCCCTTAGAGG + Intronic
1168487034 19:56772260-56772282 AATTTCAAGGTCCTCCTTAGAGG - Intergenic
925165876 2:1715318-1715340 ATTTTCCCGGACATACTTAGCGG - Intronic
926604205 2:14880267-14880289 CTTTTCCTGTTCATCCTAAAAGG - Intergenic
926820024 2:16841725-16841747 CTTTCCTGGGTCTTCCTTAGAGG - Intergenic
928120288 2:28579028-28579050 CTTTTCCAGGTCCTCTTTGGAGG + Intronic
929223319 2:39487599-39487621 CCTTTCCAGCACATCCTTAAAGG - Intergenic
931133480 2:59367603-59367625 CTTTTCCAGCCTATTCTTAGTGG - Intergenic
933225529 2:79744484-79744506 CTTTTCCAGGAAATTCTGAGTGG - Exonic
938383647 2:130850142-130850164 CGTTTCTAGGGCATCCTCAGAGG + Intronic
940444533 2:153762575-153762597 CTTTTTCAGTTCTTCCTTAGTGG + Intergenic
940522281 2:154766469-154766491 CTTTTCCAGGTTACCCAAAGTGG + Intronic
940954511 2:159712771-159712793 CTTCTCCACCTCATCCTGAGAGG - Intronic
943112929 2:183628686-183628708 CTTTTCCAGTTCATCCTCATGGG + Intergenic
946861240 2:224001909-224001931 CTTTTCCAGGTCGTCCTTGGTGG - Exonic
1172397589 20:34620019-34620041 CTTTTCCCCCTCCTCCTTAGCGG + Intronic
1173300536 20:41798432-41798454 CTCTTCCAGGTCATCCCTTGGGG + Intergenic
1177002901 21:15635643-15635665 CATTTCCAGCTCATCCACAGTGG + Intergenic
1177449227 21:21243923-21243945 ATTCTCCAGGTGATCCTTATGGG - Intronic
1179560081 21:42210216-42210238 CTTTTCCAGAACATCAGTAGTGG + Intronic
1180712961 22:17852341-17852363 CTCTTCCAGGCCAGCCTCAGTGG - Intronic
1180712969 22:17852408-17852430 CTCTTCCAGGCCAGCCTCAGTGG - Intronic
1181440522 22:22933177-22933199 CTTCACCAGCTCATTCTTAGAGG + Intergenic
1184838063 22:47035725-47035747 CTTTTCCAGGGCCAGCTTAGTGG + Intronic
952065693 3:29567265-29567287 CTTTTCCTGCTCATCCTTTTTGG - Intronic
952708186 3:36401314-36401336 CTTTTCCAGTATATTCTTAGAGG + Intronic
955742906 3:62111285-62111307 CTTTCCCAGAACATCCTTTGAGG + Intronic
958813314 3:98888438-98888460 CTTTTCAAGGTCATAGTGAGTGG - Intronic
967038552 3:185666972-185666994 CCTTTCCAGTTCATTCTTTGAGG + Intronic
967806763 3:193721137-193721159 CTTTTGGAGGTCATGGTTAGAGG - Intergenic
968748136 4:2371781-2371803 CCTTCCCAGGCCAGCCTTAGTGG - Intronic
968914816 4:3492772-3492794 CCTGTCCAGCTCATCCTCAGAGG + Exonic
968963318 4:3756679-3756701 CTTTTCCCTGCCATCCCTAGTGG - Intergenic
972738638 4:41869067-41869089 CTTTTCCTTGTCATAGTTAGAGG + Intergenic
973216561 4:47675934-47675956 CTTTTCCAAGTCATGGTAAGAGG + Intronic
977466732 4:97391435-97391457 GTTTTACAGGTCATTCTTATGGG - Intronic
979216407 4:118169945-118169967 CTTTTCCATGTGATCTTTACCGG + Intronic
980213840 4:129825340-129825362 CTTTTCTAGGTCATCATTCTAGG + Intergenic
980385728 4:132086612-132086634 CTTTTCCAGGACATCCCTGAAGG - Intergenic
980659681 4:135841218-135841240 CCTTTCTAGGACATCCTTGGAGG + Intergenic
982567369 4:157002589-157002611 TTTTTCCAGGTTACCCATAGTGG - Intergenic
986180225 5:5386133-5386155 CTTTTCCAGGTTGTCCTCATTGG + Intergenic
990350125 5:54907923-54907945 CTCTTCCAGGTCAGCATTTGCGG + Intergenic
991437520 5:66612037-66612059 ATTTTCTAGGGCATCCTAAGTGG - Intronic
993231851 5:85247119-85247141 CCTTTCTAGGACATCCTTAAAGG - Intergenic
993483247 5:88450568-88450590 TTTTTCAAAGTCATTCTTAGTGG - Intergenic
995269441 5:110204591-110204613 CATATCCAGGTCAGCCTTGGTGG + Intergenic
996424164 5:123294494-123294516 CTTTTCCAGGTTACCCTGAGAGG - Intergenic
997025135 5:130051534-130051556 ATTTTCTAGGTCATTCTTTGGGG - Intronic
998529913 5:142874928-142874950 CATTTCTGGGTCATCCTTAATGG + Intronic
1003233624 6:4276403-4276425 CTCTTCCAGCTCATCCCTGGTGG + Intergenic
1006035504 6:31208405-31208427 CACCTCCAGGTCATCCTGAGTGG + Intergenic
1006234135 6:32613385-32613407 CTTTTTCAAGTACTCCTTAGAGG + Intergenic
1006577816 6:35058904-35058926 CCTTCCCTGCTCATCCTTAGAGG + Intronic
1009450630 6:63795993-63796015 CTTGTCCAGGCCATCCTTCAAGG - Intronic
1009921595 6:70068443-70068465 CTTTTCCAGGTGGACCTTGGGGG - Exonic
1010951594 6:82043325-82043347 CTTTTTCTGGTAATCCTTTGTGG - Intergenic
1013677894 6:112487530-112487552 CTCTCCCAGGTCAACCTTAGAGG + Intergenic
1014837992 6:126182421-126182443 CTATACCAGGTCTTCCTGAGTGG - Intergenic
1017654545 6:156614871-156614893 CATTTCCAGGTTATCTTTACAGG + Intergenic
1018875574 6:167819570-167819592 CTTTGCCAGCTCATCGTAAGTGG + Intergenic
1020372113 7:7443602-7443624 CTTTTCCAGGTGGTCCTTCTGGG + Exonic
1024893100 7:54225892-54225914 GTTTTCCAGGTTCTCCTTTGAGG - Intergenic
1024900818 7:54316495-54316517 GTTTTCCAGGTTCTCCTTTGAGG + Intergenic
1032069521 7:128795159-128795181 CTTTCCCATGCCATCCTTGGAGG - Intronic
1033107405 7:138540633-138540655 CTCCTCCAGGTCATCCCTAAAGG + Intronic
1035642484 8:1194482-1194504 ACTTTCCAGGTCATCCCCAGGGG + Intergenic
1035856320 8:2980243-2980265 TTTCTCTCGGTCATCCTTAGTGG - Intronic
1038396292 8:27247948-27247970 AATTTCCTGGTCTTCCTTAGGGG - Intronic
1039742235 8:40393458-40393480 TTTTGTCAGGTCATCCTTATTGG + Intergenic
1042718709 8:71804062-71804084 TTCTTCCAGGTCATCTTTAGGGG + Intergenic
1042988765 8:74614818-74614840 CTTTTCTGTGTCATCCCTAGTGG - Intronic
1047238333 8:123062115-123062137 CTTTTCCACCTCATCCTTCCAGG + Intronic
1047335141 8:123928831-123928853 ATTTGCCAGGTCATTCTTACAGG + Intronic
1050203728 9:3176201-3176223 CTTGGCCAGGTGATCCTTTGTGG - Intergenic
1051019454 9:12524402-12524424 CCCTTCAAGGTCATCCATAGGGG - Intergenic
1053473691 9:38365485-38365507 CTTTTCCAGGACATCATAAATGG + Intergenic
1056247385 9:84709542-84709564 CTTTTCCAGGAGTTTCTTAGGGG - Intronic
1057009863 9:91591343-91591365 CTTTCTAAGGTCATCCTGAGGGG - Intronic
1059674323 9:116523439-116523461 CTATACCAGGTCAGCCTGAGAGG - Intronic
1061007487 9:127936413-127936435 GTTTTCCTGTTCATCCTTCGAGG - Intronic
1187197848 X:17105241-17105263 CTCATCAAGGTCCTCCTTAGGGG - Intronic
1189403978 X:40701215-40701237 CTTCTCCATGTCATCCAGAGTGG + Exonic
1190998913 X:55638274-55638296 CAGTCCCACGTCATCCTTAGTGG + Intergenic
1199082824 X:143595442-143595464 TTCTTCCAGGTCAGGCTTAGAGG + Intergenic
1199714535 X:150497132-150497154 TTTTTCCAGGTCTTGCTTAGGGG + Intronic
1202115370 Y:21466190-21466212 CTTATCCTGGTCTTCCTGAGAGG + Intergenic
1202124609 Y:21557026-21557048 CTTCTCCTGGTCTTCCTGAGGGG + Intergenic
1202154399 Y:21872354-21872376 CTTCTCCTGGTCTTCCTGAGGGG - Intergenic