ID: 922924867

View in Genome Browser
Species Human (GRCh38)
Location 1:229340400-229340422
Sequence GTGCCTGTATTTACCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922924867 Original CRISPR GTGCCTGTATTTACCAGCTC AGG (reversed) Intronic
901095616 1:6676837-6676859 GTGCCTGTCTCTTCCAGTTCTGG - Intronic
905114088 1:35622226-35622248 GTGCCTCTTTTTACCTGCCCTGG - Intronic
907210940 1:52820972-52820994 GTGCCTGTATTTCCAGGCTGAGG + Intronic
909053945 1:70800613-70800635 GTGCCTATGTTTCCAAGCTCTGG + Intergenic
913130620 1:115835223-115835245 GTGCCTGTCTTTCCCAGTTTAGG - Intergenic
921301343 1:213754090-213754112 GTGGCTGTATTTGTCAGCTCAGG + Intergenic
922180828 1:223231492-223231514 GTGACTGCATTTGCCAGCCCAGG - Intronic
922924867 1:229340400-229340422 GTGCCTGTATTTACCAGCTCAGG - Intronic
1062997934 10:1884764-1884786 CTGCCTGTATTTACAATTTCTGG - Intergenic
1063391437 10:5652334-5652356 GGGCCAGTGTTTGCCAGCTCGGG + Intronic
1065357210 10:24853822-24853844 CTGCCTGCATTTACCAGCTAAGG - Intronic
1067462266 10:46466509-46466531 GAGCCTGTCTTGTCCAGCTCTGG - Intergenic
1067624931 10:47918128-47918150 GAGCCTGTCTTGTCCAGCTCTGG + Intergenic
1068288764 10:54973947-54973969 GTGCCTTTATTTACTAAATCAGG + Intronic
1076056569 10:127378719-127378741 TTGCCAGTATTTACAAGCTACGG - Intronic
1077596258 11:3534367-3534389 GTGCCTGAATGTACCATCTGGGG + Intergenic
1078547305 11:12255742-12255764 GTGCATGTCCTTACCAGGTCTGG - Exonic
1084231354 11:67755758-67755780 GTTCCTGGATTTACCAGATTTGG - Intergenic
1084252164 11:67908346-67908368 GTGCCTGAATGTACCATCTGGGG + Intergenic
1084785343 11:71438679-71438701 GTGCCTGTCTCTGCCAGCCCTGG - Intronic
1084820684 11:71687688-71687710 GTGCCTGAATGTACCATCTGGGG - Intergenic
1087515468 11:99154414-99154436 GTGCCTGTTTTTGCCAGCAGTGG + Intronic
1089566919 11:119376484-119376506 ATGCCTGTACTTGCCAGCTCTGG - Intronic
1089643235 11:119861264-119861286 GTGTCTGGATTTGCCATCTCAGG - Intergenic
1091482303 12:845497-845519 GAGTTTGTATTTAACAGCTCAGG + Intronic
1092422431 12:8343139-8343161 GTGCCTGAATGTACCATCTGGGG + Intergenic
1095308467 12:40665500-40665522 GTTTTTCTATTTACCAGCTCAGG - Intergenic
1101023588 12:100578320-100578342 CTGCCTGTGTTTACCATCTCAGG - Intronic
1103921562 12:124402104-124402126 TTGCCTGGATTTATTAGCTCAGG + Intronic
1105746269 13:23379495-23379517 CTCCCTGTATTTTCCAGCACTGG - Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1119507325 14:75184096-75184118 GTGCCTGTAGTCCCCAGCACTGG - Intergenic
1125579953 15:40778222-40778244 GTGCTTGTATTCACCATTTCTGG - Intronic
1131294924 15:91139451-91139473 CTGCCTCCATTTCCCAGCTCTGG - Intronic
1133375849 16:5286461-5286483 GTGCCTGAATGTACCATCTGGGG - Intergenic
1134430302 16:14198034-14198056 GTCTCTGAATTTACCAGTTCTGG + Intronic
1136006729 16:27335630-27335652 GTGCCTGTTTTGTCCAGGTCAGG + Intronic
1141969390 16:87470203-87470225 GTGCCTGTACCTAGCTGCTCAGG + Intronic
1144194281 17:12875465-12875487 GTGCCTGTAGTCCCCAGCTCGGG + Intronic
1148785202 17:50142810-50142832 GTGCCTGTATTGAGCATCTGTGG - Intronic
1152204306 17:78966318-78966340 GTGCCTCTGTTCACCAGATCTGG - Intergenic
1153202639 18:2661647-2661669 TTGCCTGTATTTTCCTGCACTGG - Intronic
1153679456 18:7486286-7486308 GTGTCTGAATTTTCCAACTCAGG - Intergenic
1154160564 18:11978344-11978366 GTGCCTGTAGTCCCCAGCTGTGG - Intergenic
1155276719 18:24195409-24195431 GTGACTGTACTTCCCAGCACAGG + Intronic
1156472179 18:37384241-37384263 GTGACAGCATTTAGCAGCTCAGG - Intronic
1156504330 18:37579524-37579546 GTGCCTCCATTTCCCAACTCAGG - Intergenic
1157507075 18:48234522-48234544 GTGTGTGTATTTACCTGCTAGGG + Intronic
1158011844 18:52737634-52737656 GTCCCTGTCTTCACCACCTCTGG - Intronic
1158929225 18:62305154-62305176 TTGGCTCTGTTTACCAGCTCGGG - Intronic
1162819577 19:13214394-13214416 GTCCCTGTGTATACCAGCCCAGG + Intronic
1165589252 19:36953072-36953094 GTGTTTTTATTTACTAGCTCCGG + Intronic
1167034678 19:46988097-46988119 GTGTCTGCCTTGACCAGCTCTGG - Intronic
925513121 2:4649609-4649631 GTGCCTGCAGCTACCAGCTTTGG + Intergenic
927754697 2:25699328-25699350 GAGCCTATTTTTCCCAGCTCAGG - Intergenic
931566150 2:63617910-63617932 GTGTTTGTATTTACCTGATCTGG - Intronic
937198087 2:120178084-120178106 GGGACAGTATTTACCATCTCTGG - Exonic
943499068 2:188664329-188664351 GTGCCTGTATTTACCGTCCATGG + Intergenic
948050777 2:234977762-234977784 GTGCGTGTCTTTCCCAGCGCAGG - Intronic
1169534629 20:6525160-6525182 GTGCCAGTATATACCACCCCAGG - Intergenic
1171091068 20:22286180-22286202 GTGCATTTATTTACCAACTGTGG + Intergenic
1172101129 20:32484267-32484289 GTGCCTGGCTTTCCCAGCCCGGG - Intronic
1173713678 20:45182125-45182147 GTGCCTGTTTTTACCTCCTAGGG - Intergenic
1176063737 20:63183506-63183528 GTGCCTGTACTTACCACGTGAGG + Intergenic
1178047493 21:28711840-28711862 GTGCCCATATTTTCGAGCTCTGG + Intergenic
1178424242 21:32466688-32466710 GTTCCTGGATTTACCAGATTTGG + Intronic
1179358445 21:40683181-40683203 GTTCCTGTATTTGGCAGCTCTGG - Intronic
1179399817 21:41073538-41073560 GTGCCTGTATGGACAAGTTCCGG - Intergenic
1182889968 22:33809407-33809429 ATGCCTGTTTTGACCAGCACTGG + Intronic
1183871218 22:40743922-40743944 GTGCCTGTAATCTCCAGCTCAGG - Intergenic
953574891 3:44105095-44105117 GTGCCAGTGTCTCCCAGCTCAGG + Intergenic
955084292 3:55687841-55687863 GTGTCTGTTTTTCCCGGCTCTGG - Intronic
957047890 3:75390595-75390617 GTTCCTGGATTTACCAGATTTGG - Intergenic
957066224 3:75524732-75524754 GTGCCTGAATGTACCATCTGGGG + Intergenic
959477281 3:106826374-106826396 GTGCCTGTCTTGAAAAGCTCTGG - Intergenic
961879970 3:130054730-130054752 GTTCCTGGATTTACCAGATTTGG - Intergenic
962149874 3:132881497-132881519 ATGCCTCTATTTTTCAGCTCTGG - Intergenic
963589248 3:147235928-147235950 GTCCCTTTATTTACAATCTCTGG - Intergenic
964120635 3:153179595-153179617 ATGCCTGTATTTCAAAGCTCTGG + Intergenic
968725422 4:2245729-2245751 CTCCCTGCATTCACCAGCTCAGG - Intergenic
968992354 4:3923068-3923090 GTTCCTGGATTTACCAGATTTGG - Intergenic
969010835 4:4060813-4060835 GTGCCTGAATGTACCATCTGGGG + Intergenic
969743231 4:9049078-9049100 GTGCCTGAATGTACCATCTGGGG - Intergenic
969802611 4:9581173-9581195 GTGCCTGAATGTACCATCTGGGG - Intergenic
969822994 4:9734596-9734618 GTTCCTGGATTTACCAGATTTGG + Intergenic
970969168 4:21961397-21961419 GTTCCTGTGCTTACCAGCTAGGG + Intergenic
971171699 4:24240358-24240380 GTGCCTTTTCTTATCAGCTCTGG - Intergenic
972221781 4:36964241-36964263 GGGCCAGTATGTACCAGCTGTGG + Intergenic
986286962 5:6366331-6366353 GAACCTGTACTTACCAGCTCAGG + Intergenic
987417703 5:17681504-17681526 GACCCTCTAGTTACCAGCTCAGG + Intergenic
994908136 5:105867594-105867616 TTTACTGTATTTACCAGTTCAGG + Intergenic
996281127 5:121730198-121730220 GTACCTGTATTTACCAGGGGAGG + Intergenic
998155152 5:139781990-139782012 CTGCCTGGATTTACCTGCCCAGG + Intergenic
998387194 5:141764213-141764235 CAGCCTGAATTTACCAGCCCTGG - Intergenic
999685630 5:154100464-154100486 AAGCCTGTATTTACCACTTCTGG - Intronic
1000345862 5:160312668-160312690 GAGCCTTTCTTTGCCAGCTCTGG + Intronic
1001199450 5:169702775-169702797 TTGCCTGAATAAACCAGCTCAGG - Intronic
1002057738 5:176608499-176608521 GTGGATGTATGTACCAGCTTGGG + Intronic
1012358794 6:98350599-98350621 CTGCCTGCAGTTTCCAGCTCAGG - Intergenic
1013482788 6:110566531-110566553 GGGCCTTTATTAACCAGCCCTGG - Intergenic
1016083342 6:139882050-139882072 GTGCCTATGTTGACCAGATCAGG - Intergenic
1017988085 6:159462217-159462239 GTCCCTCTATTTACCAGCGGAGG - Intergenic
1020069667 7:5218102-5218124 GGTCCTATACTTACCAGCTCCGG + Intronic
1021026778 7:15677655-15677677 GTCCCTGCATTTACCCTCTCAGG + Intronic
1024117738 7:46209353-46209375 GGGCCTGTATTAATCAGCTTGGG + Intergenic
1025704055 7:63846307-63846329 GTGCCTGTACCTAGCTGCTCAGG - Intergenic
1029070116 7:97888823-97888845 GTGCCTGAATGTACCATCTGGGG + Intergenic
1030162465 7:106523066-106523088 GTGCCTCTATTTGTCAGCTAGGG - Intergenic
1031043710 7:116863756-116863778 GTACCTGTATTTTCCTGCACTGG - Intronic
1032821602 7:135529145-135529167 ATGCCTGTATGTCCTAGCTCAGG + Intergenic
1033410305 7:141111422-141111444 GTGCCTGTATTTGCTGGCTCAGG - Intronic
1034295836 7:149971761-149971783 GTGCCTGTAGAAACCAGATCAGG - Intergenic
1034810217 7:154125143-154125165 GTGCCTGTAGAAACCAGATCAGG + Intronic
1034855756 7:154545038-154545060 CTTGCTGTAATTACCAGCTCTGG - Intronic
1036222992 8:6936612-6936634 GTGGCTTTACTTACCATCTCTGG - Intronic
1036248440 8:7140865-7140887 GTGCCTGAATGTACCATCTGGGG - Intergenic
1038063968 8:23941988-23942010 GTGGCTGTATTCACCTGCCCAGG - Intergenic
1038553595 8:28490597-28490619 GAGCCTGCATTTCGCAGCTCCGG - Intergenic
1041181902 8:55258026-55258048 GTGCCTGGGGTCACCAGCTCAGG - Intronic
1046072935 8:109280728-109280750 GTGCTTTGTTTTACCAGCTCTGG - Intronic
1048159356 8:131999630-131999652 TAGCTTGTATTTACCAGCTATGG + Intronic
1048555799 8:135474917-135474939 GTGCCTGAGCTTTCCAGCTCTGG + Intronic
1049544910 8:143226054-143226076 GTGCCTGTGTTTACCAGCCTGGG - Intergenic
1050148703 9:2597686-2597708 GTTCCAGCATTTACCAGCTGGGG - Intergenic
1055033206 9:71791402-71791424 CTGCCTGTCATTACCAGCTCCGG - Intronic
1055574387 9:77647484-77647506 GTGCCTGTTCTTTCCATCTCTGG - Intronic
1055722180 9:79187626-79187648 GTGACTGGATTTCCCAGATCTGG + Intergenic
1059441872 9:114312304-114312326 GTGCGTGTTTGTAGCAGCTCGGG + Exonic
1059772192 9:117437660-117437682 GTGACTCCATTTACCAGTTCTGG + Intergenic
1061419599 9:130466173-130466195 GGGGCTCTTTTTACCAGCTCAGG + Intronic
1061755792 9:132811649-132811671 CTGCCTGTCTTTGCCATCTCTGG - Intronic
1061912717 9:133733574-133733596 CTGCCTGGAGTTTCCAGCTCTGG + Intronic
1188277657 X:28220565-28220587 CAGCCTGTATTTACCATTTCTGG - Intergenic
1189117443 X:38357655-38357677 GTGTCTGCATTTTCCAACTCTGG - Intronic
1190419439 X:50214105-50214127 GTGCCTGTAGTTAACAGCATTGG - Intronic
1192059222 X:67806388-67806410 GTATTTGTATTTGCCAGCTCTGG - Intergenic