ID: 922926045

View in Genome Browser
Species Human (GRCh38)
Location 1:229347377-229347399
Sequence CCTTCAGTACTGTATGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922926043_922926045 -10 Left 922926043 1:229347364-229347386 CCATTGTGGCTGTCCTTCAGTAC No data
Right 922926045 1:229347377-229347399 CCTTCAGTACTGTATGAACAAGG No data
922926042_922926045 -4 Left 922926042 1:229347358-229347380 CCTCGTCCATTGTGGCTGTCCTT No data
Right 922926045 1:229347377-229347399 CCTTCAGTACTGTATGAACAAGG No data
922926039_922926045 26 Left 922926039 1:229347328-229347350 CCTCATCTCATCTGCAGAACAAA No data
Right 922926045 1:229347377-229347399 CCTTCAGTACTGTATGAACAAGG No data
922926041_922926045 -3 Left 922926041 1:229347357-229347379 CCCTCGTCCATTGTGGCTGTCCT No data
Right 922926045 1:229347377-229347399 CCTTCAGTACTGTATGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922926045 Original CRISPR CCTTCAGTACTGTATGAACA AGG Intergenic
No off target data available for this crispr