ID: 922928118

View in Genome Browser
Species Human (GRCh38)
Location 1:229367619-229367641
Sequence TTTTGGGAGGCCGAGGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 542038
Summary {0: 1290, 1: 45467, 2: 132962, 3: 201493, 4: 160826}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928118_922928129 21 Left 922928118 1:229367619-229367641 CCACCCGCCTCGGCCTCCCAAAA 0: 1290
1: 45467
2: 132962
3: 201493
4: 160826
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928118_922928125 -8 Left 922928118 1:229367619-229367641 CCACCCGCCTCGGCCTCCCAAAA 0: 1290
1: 45467
2: 132962
3: 201493
4: 160826
Right 922928125 1:229367634-229367656 TCCCAAAATGCTGGGATTACAGG 0: 13221
1: 306476
2: 262600
3: 198956
4: 220194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928118 Original CRISPR TTTTGGGAGGCCGAGGCGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr