ID: 922928119

View in Genome Browser
Species Human (GRCh38)
Location 1:229367622-229367644
Sequence GCATTTTGGGAGGCCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 812633
Summary {0: 3197, 1: 96511, 2: 232732, 3: 241203, 4: 238990}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928119_922928134 30 Left 922928119 1:229367622-229367644 CCCGCCTCGGCCTCCCAAAATGC 0: 3197
1: 96511
2: 232732
3: 241203
4: 238990
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928119_922928129 18 Left 922928119 1:229367622-229367644 CCCGCCTCGGCCTCCCAAAATGC 0: 3197
1: 96511
2: 232732
3: 241203
4: 238990
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928119_922928133 29 Left 922928119 1:229367622-229367644 CCCGCCTCGGCCTCCCAAAATGC 0: 3197
1: 96511
2: 232732
3: 241203
4: 238990
Right 922928133 1:229367674-229367696 TGACAAATGAGGCTTTTGTAGGG No data
922928119_922928132 28 Left 922928119 1:229367622-229367644 CCCGCCTCGGCCTCCCAAAATGC 0: 3197
1: 96511
2: 232732
3: 241203
4: 238990
Right 922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928119 Original CRISPR GCATTTTGGGAGGCCGAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr