ID: 922928120

View in Genome Browser
Species Human (GRCh38)
Location 1:229367623-229367645
Sequence AGCATTTTGGGAGGCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 513277
Summary {0: 3308, 1: 98747, 2: 190507, 3: 136049, 4: 84666}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928120_922928129 17 Left 922928120 1:229367623-229367645 CCGCCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928120_922928134 29 Left 922928120 1:229367623-229367645 CCGCCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928120_922928133 28 Left 922928120 1:229367623-229367645 CCGCCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 922928133 1:229367674-229367696 TGACAAATGAGGCTTTTGTAGGG No data
922928120_922928132 27 Left 922928120 1:229367623-229367645 CCGCCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928120 Original CRISPR AGCATTTTGGGAGGCCGAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr