ID: 922928122

View in Genome Browser
Species Human (GRCh38)
Location 1:229367626-229367648
Sequence CCCAGCATTTTGGGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 848443
Summary {0: 4469, 1: 129842, 2: 272674, 3: 216516, 4: 224942}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928122_922928132 24 Left 922928122 1:229367626-229367648 CCTCGGCCTCCCAAAATGCTGGG 0: 4469
1: 129842
2: 272674
3: 216516
4: 224942
Right 922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG No data
922928122_922928129 14 Left 922928122 1:229367626-229367648 CCTCGGCCTCCCAAAATGCTGGG 0: 4469
1: 129842
2: 272674
3: 216516
4: 224942
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928122_922928134 26 Left 922928122 1:229367626-229367648 CCTCGGCCTCCCAAAATGCTGGG 0: 4469
1: 129842
2: 272674
3: 216516
4: 224942
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928122_922928133 25 Left 922928122 1:229367626-229367648 CCTCGGCCTCCCAAAATGCTGGG 0: 4469
1: 129842
2: 272674
3: 216516
4: 224942
Right 922928133 1:229367674-229367696 TGACAAATGAGGCTTTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928122 Original CRISPR CCCAGCATTTTGGGAGGCCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr