ID: 922928124

View in Genome Browser
Species Human (GRCh38)
Location 1:229367632-229367654
Sequence TGTAATCCCAGCATTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928124_922928134 20 Left 922928124 1:229367632-229367654 CCTCCCAAAATGCTGGGATTACA No data
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928124_922928129 8 Left 922928124 1:229367632-229367654 CCTCCCAAAATGCTGGGATTACA No data
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928124_922928133 19 Left 922928124 1:229367632-229367654 CCTCCCAAAATGCTGGGATTACA No data
Right 922928133 1:229367674-229367696 TGACAAATGAGGCTTTTGTAGGG No data
922928124_922928132 18 Left 922928124 1:229367632-229367654 CCTCCCAAAATGCTGGGATTACA No data
Right 922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928124 Original CRISPR TGTAATCCCAGCATTTTGGG AGG (reversed) Intergenic