ID: 922928126

View in Genome Browser
Species Human (GRCh38)
Location 1:229367635-229367657
Sequence GCCTGTAATCCCAGCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1009499
Summary {0: 9429, 1: 235524, 2: 277870, 3: 222838, 4: 263838}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928126_922928129 5 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928126_922928133 16 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928133 1:229367674-229367696 TGACAAATGAGGCTTTTGTAGGG No data
922928126_922928135 29 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928135 1:229367687-229367709 TTTTGTAGGGGTTGAGATTCAGG No data
922928126_922928132 15 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG No data
922928126_922928134 17 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928126 Original CRISPR GCCTGTAATCCCAGCATTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr