ID: 922928127

View in Genome Browser
Species Human (GRCh38)
Location 1:229367636-229367658
Sequence CGCCTGTAATCCCAGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 948132
Summary {0: 4469, 1: 137853, 2: 283836, 3: 246810, 4: 275164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928127_922928129 4 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928127_922928133 15 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928133 1:229367674-229367696 TGACAAATGAGGCTTTTGTAGGG No data
922928127_922928135 28 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928135 1:229367687-229367709 TTTTGTAGGGGTTGAGATTCAGG No data
922928127_922928134 16 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928127_922928132 14 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928127 Original CRISPR CGCCTGTAATCCCAGCATTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr