ID: 922928129

View in Genome Browser
Species Human (GRCh38)
Location 1:229367663-229367685
Sequence CCACTGTGCCCTGACAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928120_922928129 17 Left 922928120 1:229367623-229367645 CCGCCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928124_922928129 8 Left 922928124 1:229367632-229367654 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928118_922928129 21 Left 922928118 1:229367619-229367641 CCACCCGCCTCGGCCTCCCAAAA 0: 1290
1: 45467
2: 132962
3: 201493
4: 160826
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928127_922928129 4 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928122_922928129 14 Left 922928122 1:229367626-229367648 CCTCGGCCTCCCAAAATGCTGGG 0: 4469
1: 129842
2: 272674
3: 216516
4: 224942
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928119_922928129 18 Left 922928119 1:229367622-229367644 CCCGCCTCGGCCTCCCAAAATGC 0: 3197
1: 96511
2: 232732
3: 241203
4: 238990
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
922928126_922928129 5 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928129 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928129 Original CRISPR CCACTGTGCCCTGACAAATG AGG Intergenic
No off target data available for this crispr