ID: 922928134

View in Genome Browser
Species Human (GRCh38)
Location 1:229367675-229367697
Sequence GACAAATGAGGCTTTTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928122_922928134 26 Left 922928122 1:229367626-229367648 CCTCGGCCTCCCAAAATGCTGGG 0: 4469
1: 129842
2: 272674
3: 216516
4: 224942
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928119_922928134 30 Left 922928119 1:229367622-229367644 CCCGCCTCGGCCTCCCAAAATGC 0: 3197
1: 96511
2: 232732
3: 241203
4: 238990
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928127_922928134 16 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928124_922928134 20 Left 922928124 1:229367632-229367654 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928120_922928134 29 Left 922928120 1:229367623-229367645 CCGCCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data
922928126_922928134 17 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928134 1:229367675-229367697 GACAAATGAGGCTTTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928134 Original CRISPR GACAAATGAGGCTTTTGTAG GGG Intergenic
No off target data available for this crispr