ID: 922928135

View in Genome Browser
Species Human (GRCh38)
Location 1:229367687-229367709
Sequence TTTTGTAGGGGTTGAGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922928128_922928135 1 Left 922928128 1:229367663-229367685 CCACTGTGCCCTGACAAATGAGG No data
Right 922928135 1:229367687-229367709 TTTTGTAGGGGTTGAGATTCAGG No data
922928131_922928135 -8 Left 922928131 1:229367672-229367694 CCTGACAAATGAGGCTTTTGTAG No data
Right 922928135 1:229367687-229367709 TTTTGTAGGGGTTGAGATTCAGG No data
922928126_922928135 29 Left 922928126 1:229367635-229367657 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 922928135 1:229367687-229367709 TTTTGTAGGGGTTGAGATTCAGG No data
922928127_922928135 28 Left 922928127 1:229367636-229367658 CCAAAATGCTGGGATTACAGGCG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
Right 922928135 1:229367687-229367709 TTTTGTAGGGGTTGAGATTCAGG No data
922928130_922928135 -7 Left 922928130 1:229367671-229367693 CCCTGACAAATGAGGCTTTTGTA No data
Right 922928135 1:229367687-229367709 TTTTGTAGGGGTTGAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922928135 Original CRISPR TTTTGTAGGGGTTGAGATTC AGG Intergenic
No off target data available for this crispr