ID: 922930040

View in Genome Browser
Species Human (GRCh38)
Location 1:229381881-229381903
Sequence TGCCCAAGGGTGCCAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922930033_922930040 6 Left 922930033 1:229381852-229381874 CCAGGCTGGAGTGCCCCTCTGTG No data
Right 922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG No data
922930035_922930040 -8 Left 922930035 1:229381866-229381888 CCCTCTGTGACAGCCTGCCCAAG No data
Right 922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG No data
922930034_922930040 -7 Left 922930034 1:229381865-229381887 CCCCTCTGTGACAGCCTGCCCAA No data
Right 922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG No data
922930032_922930040 7 Left 922930032 1:229381851-229381873 CCCAGGCTGGAGTGCCCCTCTGT No data
Right 922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG No data
922930036_922930040 -9 Left 922930036 1:229381867-229381889 CCTCTGTGACAGCCTGCCCAAGG No data
Right 922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922930040 Original CRISPR TGCCCAAGGGTGCCAGTGCC AGG Intergenic
No off target data available for this crispr