ID: 922932892

View in Genome Browser
Species Human (GRCh38)
Location 1:229403894-229403916
Sequence GTTCCCCTTTCCCGAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922932892_922932903 27 Left 922932892 1:229403894-229403916 CCTGCCCCTCGGGAAAGGGGAAC No data
Right 922932903 1:229403944-229403966 CACCTAGAGGTTTCTGAGCAAGG No data
922932892_922932900 14 Left 922932892 1:229403894-229403916 CCTGCCCCTCGGGAAAGGGGAAC No data
Right 922932900 1:229403931-229403953 GATCCAGCCAGGGCACCTAGAGG No data
922932892_922932898 3 Left 922932892 1:229403894-229403916 CCTGCCCCTCGGGAAAGGGGAAC No data
Right 922932898 1:229403920-229403942 TGGACGCTAATGATCCAGCCAGG No data
922932892_922932899 4 Left 922932892 1:229403894-229403916 CCTGCCCCTCGGGAAAGGGGAAC No data
Right 922932899 1:229403921-229403943 GGACGCTAATGATCCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922932892 Original CRISPR GTTCCCCTTTCCCGAGGGGC AGG (reversed) Intergenic