ID: 922933876

View in Genome Browser
Species Human (GRCh38)
Location 1:229409496-229409518
Sequence CACCCAGGGACGGCTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922933876_922933890 25 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933890 1:229409544-229409566 GGCACGTTATGAAGGAAACTTGG No data
922933876_922933886 4 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933886 1:229409523-229409545 GACCTGCATGGGCTCCTAGGGGG No data
922933876_922933883 1 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933883 1:229409520-229409542 AAGGACCTGCATGGGCTCCTAGG No data
922933876_922933884 2 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933884 1:229409521-229409543 AGGACCTGCATGGGCTCCTAGGG No data
922933876_922933882 -7 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933882 1:229409512-229409534 CTGGGTGTAAGGACCTGCATGGG No data
922933876_922933885 3 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933885 1:229409522-229409544 GGACCTGCATGGGCTCCTAGGGG No data
922933876_922933888 17 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933888 1:229409536-229409558 TCCTAGGGGGCACGTTATGAAGG No data
922933876_922933881 -8 Left 922933876 1:229409496-229409518 CCTCTCTGAGCCGTCCCTGGGTG No data
Right 922933881 1:229409511-229409533 CCTGGGTGTAAGGACCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922933876 Original CRISPR CACCCAGGGACGGCTCAGAG AGG (reversed) Intergenic
No off target data available for this crispr