ID: 922934073

View in Genome Browser
Species Human (GRCh38)
Location 1:229410390-229410412
Sequence GCATCCATCCCAGGCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922934058_922934073 28 Left 922934058 1:229410339-229410361 CCATGCCTCTTCTCCACCAAACC No data
Right 922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG No data
922934064_922934073 12 Left 922934064 1:229410355-229410377 CCAAACCCAGGAGCTGGGAGCGA No data
Right 922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG No data
922934066_922934073 6 Left 922934066 1:229410361-229410383 CCAGGAGCTGGGAGCGAACAGCA No data
Right 922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG No data
922934060_922934073 23 Left 922934060 1:229410344-229410366 CCTCTTCTCCACCAAACCCAGGA No data
Right 922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG No data
922934057_922934073 29 Left 922934057 1:229410338-229410360 CCCATGCCTCTTCTCCACCAAAC No data
Right 922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG No data
922934063_922934073 15 Left 922934063 1:229410352-229410374 CCACCAAACCCAGGAGCTGGGAG No data
Right 922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG No data
922934065_922934073 7 Left 922934065 1:229410360-229410382 CCCAGGAGCTGGGAGCGAACAGC No data
Right 922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922934073 Original CRISPR GCATCCATCCCAGGCACACA GGG Intergenic
No off target data available for this crispr