ID: 922936507

View in Genome Browser
Species Human (GRCh38)
Location 1:229426898-229426920
Sequence TAGAAGGACTGCAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922936507_922936515 -1 Left 922936507 1:229426898-229426920 CCCATTTCCCTGCAGTCCTTCTA No data
Right 922936515 1:229426920-229426942 AGCTGAGGCACTGCTGGGTGAGG No data
922936507_922936514 -6 Left 922936507 1:229426898-229426920 CCCATTTCCCTGCAGTCCTTCTA No data
Right 922936514 1:229426915-229426937 CTTCTAGCTGAGGCACTGCTGGG No data
922936507_922936520 30 Left 922936507 1:229426898-229426920 CCCATTTCCCTGCAGTCCTTCTA No data
Right 922936520 1:229426951-229426973 CTTTCTATGTCCCTGGAGCTGGG No data
922936507_922936517 23 Left 922936507 1:229426898-229426920 CCCATTTCCCTGCAGTCCTTCTA No data
Right 922936517 1:229426944-229426966 CATGCCACTTTCTATGTCCCTGG No data
922936507_922936519 29 Left 922936507 1:229426898-229426920 CCCATTTCCCTGCAGTCCTTCTA No data
Right 922936519 1:229426950-229426972 ACTTTCTATGTCCCTGGAGCTGG No data
922936507_922936513 -7 Left 922936507 1:229426898-229426920 CCCATTTCCCTGCAGTCCTTCTA No data
Right 922936513 1:229426914-229426936 CCTTCTAGCTGAGGCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922936507 Original CRISPR TAGAAGGACTGCAGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr