ID: 922937856

View in Genome Browser
Species Human (GRCh38)
Location 1:229434809-229434831
Sequence CAGGATAGACAACTGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922937848_922937856 5 Left 922937848 1:229434781-229434803 CCGGCGGCCGGAGGGCGCGCAGC 0: 1
1: 0
2: 0
3: 19
4: 212
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937841_922937856 23 Left 922937841 1:229434763-229434785 CCACCGCACAGAGGGCCACCGGC 0: 1
1: 0
2: 1
3: 8
4: 127
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937838_922937856 25 Left 922937838 1:229434761-229434783 CCCCACCGCACAGAGGGCCACCG 0: 1
1: 0
2: 2
3: 8
4: 103
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937849_922937856 -2 Left 922937849 1:229434788-229434810 CCGGAGGGCGCGCAGCTGTCGCA 0: 1
1: 0
2: 0
3: 4
4: 49
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937843_922937856 20 Left 922937843 1:229434766-229434788 CCGCACAGAGGGCCACCGGCGGC 0: 1
1: 0
2: 1
3: 4
4: 108
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937847_922937856 8 Left 922937847 1:229434778-229434800 CCACCGGCGGCCGGAGGGCGCGC 0: 1
1: 0
2: 2
3: 20
4: 206
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937839_922937856 24 Left 922937839 1:229434762-229434784 CCCACCGCACAGAGGGCCACCGG 0: 1
1: 0
2: 2
3: 4
4: 98
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937837_922937856 26 Left 922937837 1:229434760-229434782 CCCCCACCGCACAGAGGGCCACC 0: 1
1: 0
2: 1
3: 18
4: 159
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
922937836_922937856 30 Left 922937836 1:229434756-229434778 CCTTCCCCCACCGCACAGAGGGC 0: 1
1: 0
2: 0
3: 47
4: 760
Right 922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922937856 Original CRISPR CAGGATAGACAACTGGCGGG GGG Intergenic
901178186 1:7320439-7320461 TAGGAAAGACATCTGGCTGGTGG + Intronic
901287724 1:8094429-8094451 CAAGATACGCAACTGGCAGGAGG - Intergenic
901510553 1:9716257-9716279 CAGGATAACCAAGTGGCGTGGGG + Intronic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
907046292 1:51302245-51302267 CAGGATAGACTGGGGGCGGGGGG - Intronic
914006259 1:143735113-143735135 TAGTATAGACAACTGGGGGCTGG - Intergenic
922027205 1:221761482-221761504 CAGGGCAGACAAATGGCAGGTGG + Intergenic
922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG + Intergenic
1064013822 10:11757898-11757920 CAGCAAAGACAACGGGCAGGTGG - Intronic
1064775540 10:18772922-18772944 CAGGAAAGACAACTGCAAGGTGG + Intergenic
1067285468 10:44904564-44904586 AAGGATCAACAACTGTCGGGGGG + Intergenic
1076547185 10:131253228-131253250 CAGGAATGACAGCTGGTGGGTGG + Intronic
1081626533 11:44659260-44659282 AAGGATAGAGAAGTGGCTGGAGG + Intergenic
1084515800 11:69637480-69637502 CAGGAGAGAAAGCTGGCTGGGGG - Intergenic
1091472085 12:737770-737792 CAGGATAGACATCCTGAGGGAGG - Intergenic
1091770658 12:3149042-3149064 CCAGAGAGACAAATGGCGGGGGG - Intronic
1096843663 12:54393546-54393568 CAGGAGAGGCAGCTGGCAGGCGG - Intergenic
1102947553 12:117002800-117002822 AAAGATAGACAACTGGGGAGAGG - Intronic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106909717 13:34450565-34450587 CAGGAGAGTAAACAGGCGGGTGG - Intergenic
1108579545 13:51817102-51817124 CAGGAGAGACACCTGGGGCGTGG + Intergenic
1109446169 13:62443716-62443738 CAGGATAGAGAATTGGCAGGAGG + Intergenic
1109817312 13:67602175-67602197 CAGGATAGGAATCTGGTGGGAGG - Intergenic
1113956467 13:114102199-114102221 CAGGATCCACAGCGGGCGGGTGG + Intronic
1121129163 14:91429468-91429490 CAGAGTAGATAGCTGGCGGGAGG + Intergenic
1124661713 15:31555138-31555160 CAGGATGGACAGCTGGATGGTGG + Intronic
1125395539 15:39243628-39243650 CAGGAATGACAACTGGCAAGGGG - Intergenic
1129454699 15:75670441-75670463 CAGGATAGCCCACAGGCTGGGGG + Intergenic
1132495192 16:259831-259853 CAGGAGATCCACCTGGCGGGAGG + Intronic
1134241581 16:12510731-12510753 CAGGCTGGACAGCTGGGGGGTGG - Intronic
1138305176 16:55967743-55967765 AAGTATAGACAACTGGCTGGAGG + Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1142363202 16:89636863-89636885 CAGGGCTGACAACTGGCTGGTGG + Exonic
1152159010 17:78655695-78655717 CAGGAGAGGCAAATGGTGGGCGG + Intergenic
1158491773 18:57916496-57916518 CAGGACAGAAATCTGGCCGGGGG + Intergenic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1161809626 19:6464521-6464543 CAGGAGAGACAACTGGCGCCAGG - Intronic
1164311112 19:24047380-24047402 TAGGAAAGAAAACAGGCGGGAGG - Intronic
1168035094 19:53712911-53712933 CAGGATAGACCACAGGCTAGTGG - Intergenic
925541991 2:4976544-4976566 CAGGATAGAGACCTGCCCGGGGG - Intergenic
926845862 2:17138504-17138526 GAGGATAGACAACTGGCTGAGGG + Intergenic
926919643 2:17927714-17927736 CAAGAAAGAGAACTGGTGGGAGG - Intronic
942230320 2:173855057-173855079 CAGGAGGGACAGCTGGCAGGAGG - Intergenic
944507235 2:200425138-200425160 CAGGAAGCACAAATGGCGGGGGG - Intronic
947897919 2:233692660-233692682 CGGGATAGAGAATTGGCAGGGGG + Intronic
1170868809 20:20185561-20185583 CAGGAAAGACAGCTGGGTGGAGG + Intronic
1171186893 20:23129187-23129209 GAGGATAGAGAAATGGAGGGAGG + Intergenic
1173418631 20:42880683-42880705 CAGGATAGACAGCTAGAGAGAGG + Intronic
1174340701 20:49893289-49893311 GAGGCTAGAAAGCTGGCGGGGGG + Intergenic
1178212964 21:30558954-30558976 CAGGGTAGGGAACTGGTGGGAGG + Intronic
1183025932 22:35065999-35066021 CAGGGTAGAAAAGTGGCAGGAGG - Intergenic
952843502 3:37667816-37667838 CAGGAGAAACACCTGGTGGGAGG + Intronic
955417439 3:58705650-58705672 CAGGATAGACCACAGACTGGAGG - Intergenic
956955590 3:74335468-74335490 CATGATAGACAAATGGAAGGAGG - Intronic
958139520 3:89543401-89543423 CAGGATAGCCAACTGGAGGATGG + Intergenic
959150241 3:102599387-102599409 CAGGGGAGACACCTGGTGGGAGG - Intergenic
959601688 3:108193917-108193939 CAGGATAGACTAATGGGGGCTGG + Intronic
964400321 3:156291392-156291414 CAGGATGCTCAACTGGCGCGCGG - Intronic
965814868 3:172625872-172625894 CAGGAGAGACATCTGGAAGGAGG + Intergenic
968873642 4:3254077-3254099 CAGGACAGACACCTGCGGGGTGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
976361270 4:84181534-84181556 CTGGGTAGACAACTGGGGGTTGG - Intergenic
978484202 4:109231510-109231532 CAGGAAAGACAACTGCAGAGAGG + Intronic
982242183 4:153311420-153311442 CAGGATAGACAAAAGGCTAGAGG + Intronic
984959609 4:185082937-185082959 TAGGCTAGACAACTGGGGGGCGG + Intergenic
985653251 5:1116794-1116816 CAGGAACGAGAGCTGGCGGGGGG - Intergenic
985723405 5:1502470-1502492 CAGGAGAGTGAACTGGCGGGAGG + Intronic
987308550 5:16661022-16661044 TAGGATAGACACATGGTGGGAGG + Intergenic
989515810 5:42341052-42341074 CAGGAGAGGTACCTGGCGGGAGG - Intergenic
991411189 5:66347256-66347278 CAGTCTACACAACTGGCTGGAGG + Intergenic
994066786 5:95552676-95552698 CAGGAGTGAAAAATGGCGGGAGG + Intronic
997996648 5:138591890-138591912 AGGGTTAGACAACTGGCTGGTGG - Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1007412160 6:41671182-41671204 GAGGAGAGACAGGTGGCGGGAGG + Intergenic
1007666006 6:43513331-43513353 CAGGACAGACAACTTTGGGGGGG - Intronic
1013927122 6:115486671-115486693 CAGGTTATAAAACTGGCAGGAGG + Intergenic
1018638470 6:165885451-165885473 CAGGGGAGGCACCTGGCGGGAGG - Intronic
1019414956 7:922862-922884 CAGGATAGACAATGGGGGCGGGG - Intronic
1024045436 7:45582553-45582575 CAGGGCAGGCACCTGGCGGGGGG + Intronic
1027781918 7:82530650-82530672 CAGGAGAGACAAGTGGGGAGGGG - Intergenic
1029003370 7:97180439-97180461 CAGCATGGACTACTGGAGGGTGG + Intronic
1030273701 7:107696967-107696989 CAGGAAGGAGAACTGGCTGGTGG - Intronic
1033537951 7:142329091-142329113 CAGGAGAGACAACATGAGGGTGG - Intergenic
1035207038 7:157300503-157300525 CAGGCTGGACACGTGGCGGGCGG - Intergenic
1035226688 7:157437844-157437866 CAGGCTGGACAACTGGGTGGGGG - Intergenic
1035235490 7:157495092-157495114 CAGGACAGACTGCTGGTGGGAGG + Intergenic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1037069152 8:14621770-14621792 CAGGGGAGAGAACTGGTGGGAGG - Intronic
1038533899 8:28340073-28340095 CAGGATGGACAAATGGCTTGTGG - Intronic
1041390958 8:57347227-57347249 CAGGAGAGACAGCTGGCGGCAGG - Intergenic
1044225934 8:89718119-89718141 CATGAGAGACAACTGGGGGTGGG - Intergenic
1044663333 8:94612603-94612625 CATAATAGACAACTGGAGTGAGG - Intergenic
1048034670 8:130666161-130666183 CAGGACAGACACCTGGAGGCGGG - Intergenic
1049275214 8:141716919-141716941 CAGGACAGGCCACTGGTGGGAGG + Intergenic
1061315919 9:129795720-129795742 CAGGAGAGAGAAGGGGCGGGGGG + Intergenic
1188548417 X:31335842-31335864 CAGGATAGACAACTGTGGAAGGG + Intronic
1195214174 X:102681116-102681138 CAGGAGAGACTACTGGAAGGTGG - Intergenic