ID: 922937930

View in Genome Browser
Species Human (GRCh38)
Location 1:229435087-229435109
Sequence AACCCAGGACTGGCTAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922937924_922937930 7 Left 922937924 1:229435057-229435079 CCTCTCCTGGGGCTGAAAGACAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 922937930 1:229435087-229435109 AACCCAGGACTGGCTAGACCTGG 0: 1
1: 0
2: 1
3: 6
4: 154
922937927_922937930 2 Left 922937927 1:229435062-229435084 CCTGGGGCTGAAAGACAAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 195
Right 922937930 1:229435087-229435109 AACCCAGGACTGGCTAGACCTGG 0: 1
1: 0
2: 1
3: 6
4: 154
922937923_922937930 8 Left 922937923 1:229435056-229435078 CCCTCTCCTGGGGCTGAAAGACA 0: 1
1: 0
2: 0
3: 22
4: 254
Right 922937930 1:229435087-229435109 AACCCAGGACTGGCTAGACCTGG 0: 1
1: 0
2: 1
3: 6
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922937930 Original CRISPR AACCCAGGACTGGCTAGACC TGG Intergenic
900392392 1:2439341-2439363 ACCCCAGTGCTGGCCAGACCTGG + Intronic
900538965 1:3193331-3193353 CTCCTAGGAATGGCTAGACCTGG - Intronic
902863225 1:19260585-19260607 CCTCCAGGTCTGGCTAGACCTGG - Intergenic
903473350 1:23602772-23602794 GACCAAGGTCTGGCCAGACCTGG + Intronic
904752768 1:32751217-32751239 AACACAGGACAGGCTAGGCTAGG - Intronic
905284464 1:36870246-36870268 AGCTCAGGCCTGGCTAGGCCAGG - Intronic
910688174 1:89939507-89939529 ACCCCAGGATAGGCTAGGCCAGG - Intergenic
912404541 1:109426180-109426202 AACCCGAGACTGGCCGGACCTGG - Intronic
913234805 1:116770550-116770572 AGCCCAGGGCTGAATAGACCAGG - Intergenic
915139558 1:153758815-153758837 AACCCAGGCCTGGCCAGGCATGG + Intronic
915314099 1:155018328-155018350 AGCCCAGGGCTGGGGAGACCTGG + Exonic
917497714 1:175556505-175556527 AAGACAGGACAGGCTACACCAGG - Intronic
917510643 1:175666623-175666645 AACGTCGGACTGGCTGGACCCGG + Intronic
920862718 1:209723726-209723748 AACCCAAGACAGGCTAGAGGGGG - Intronic
921387871 1:214588979-214589001 AACCCATGACTTGGTAGATCTGG + Intergenic
921810456 1:219506523-219506545 AACCCAGGGACAGCTAGACCTGG - Intergenic
922572028 1:226639961-226639983 CACCCAGGACAGGCCAGCCCCGG - Intronic
922937930 1:229435087-229435109 AACCCAGGACTGGCTAGACCTGG + Intergenic
1063908092 10:10801166-10801188 AAACTTGGACTGGCAAGACCTGG + Intergenic
1064455628 10:15484959-15484981 AACCCAGGACTGGCGAGGCACGG - Intergenic
1066335518 10:34473629-34473651 AACTGAGGACTGGCTAAAACAGG + Intronic
1071336529 10:84605047-84605069 AATCCAGGAATGGAGAGACCTGG + Intergenic
1076699777 10:132265386-132265408 AGCCCAGGACTGGCTCTTCCTGG - Intronic
1077014865 11:394991-395013 AAGCCAGGCCTGTCTGGACCAGG + Intronic
1077870466 11:6258421-6258443 AACTCAGGGCTGGCTGAACCAGG + Intergenic
1078615568 11:12862280-12862302 AACTCAGGACAGGCAAGACGAGG + Exonic
1081858614 11:46319311-46319333 AACCCAGGTCTGCCTGGCCCTGG - Intronic
1082005814 11:47418427-47418449 AACCCAAGCCTGGCTTTACCAGG + Intergenic
1082770291 11:57202536-57202558 CACCCAGGAGTGGCCAGAGCTGG + Intergenic
1084410715 11:69004610-69004632 AGCCTAGGACTGGCTCGTCCCGG + Exonic
1084964737 11:72738705-72738727 GACCCAGGCCTGGCCAGAGCTGG - Intronic
1085640373 11:78189221-78189243 AACCCTGGACTTGCGAGCCCAGG + Intronic
1088737077 11:112736747-112736769 AAGCCAGGTCTGTCTGGACCTGG - Intergenic
1090352934 11:126119079-126119101 AACCAACTACTGGCTAGACAAGG + Intergenic
1091578534 12:1763685-1763707 AGTCCAGGAATGGCTGGACCTGG + Intronic
1092101466 12:5887512-5887534 AAATGAGGACTGGCTAGCCCTGG + Intronic
1100548889 12:95628291-95628313 AACCAAGGACTAGCTAAAACAGG + Intergenic
1101823407 12:108201655-108201677 AACCCAGATCTGGTTAGATCTGG + Intronic
1101903944 12:108811664-108811686 CACCCAGGACAGGCCAGGCCGGG - Intronic
1107740446 13:43444919-43444941 AACCCAGGTCTCCCTAGCCCAGG - Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1121680612 14:95789937-95789959 AAACCTAGACTGGCTAGGCCTGG - Intergenic
1122685591 14:103504074-103504096 AACCCAGAACTGTCAAGACCTGG - Intergenic
1126569977 15:50140424-50140446 AACCCAGTGCTGGGTAGACAGGG - Intronic
1127625569 15:60776741-60776763 AACCAAGGACTGTCTAGACATGG + Intronic
1129469930 15:75747202-75747224 AGTCCAGGAATGGCAAGACCAGG + Intergenic
1130900588 15:88204261-88204283 ATCCCAAGACTGGCGAGAGCAGG - Intronic
1134176380 16:12010010-12010032 AACCCAGAACTGGCAAACCCAGG - Intronic
1135135502 16:19883758-19883780 AAGGGAGGACTGGCTAGGCCTGG + Intronic
1135996357 16:27252364-27252386 AACCCAGGAATGGCCAGGCACGG + Intronic
1136083941 16:27871110-27871132 ACTCCAGGACTGGCTGGACACGG - Intronic
1136245945 16:28975762-28975784 AACCCAGGTCTGTCTTCACCTGG - Intronic
1138219894 16:55241634-55241656 AACCCAGGGCTGGCCAGACGTGG - Intergenic
1138550260 16:57743950-57743972 AACCAAGGCCTGCCTAGTCCTGG - Intronic
1141396818 16:83712332-83712354 AAACCAGGTGTGCCTAGACCTGG - Intronic
1142208603 16:88796312-88796334 CACTCAGGACAGGCAAGACCAGG - Intergenic
1142492272 17:286767-286789 AAGCCAGGACTCGCTTGCCCTGG - Intronic
1143001741 17:3799021-3799043 AATCCAGGACTGGCCTGGCCTGG - Intronic
1143066002 17:4247952-4247974 AACACAGGACTGACTACCCCGGG - Intronic
1144867751 17:18347739-18347761 CACCCAGGAGTGGCGAGAACAGG + Intronic
1146188493 17:30744426-30744448 AAGTCAGGACTGCCTAGACATGG - Intergenic
1147414122 17:40276235-40276257 AACCCAGAATTGGCTGGGCCTGG + Intronic
1148083638 17:44980991-44981013 CACCCAGGACCTGCTAGACAGGG + Intergenic
1148161726 17:45453994-45454016 AGCTGAGGACTGGCTGGACCGGG - Exonic
1150336461 17:64334156-64334178 AAGCCAAGACTGGAAAGACCAGG + Intronic
1150392961 17:64800639-64800661 AGCTGAGGACTGGCTGGACCTGG - Intergenic
1150947832 17:69766119-69766141 ATCCCAGGACTTCCAAGACCAGG - Intergenic
1152540451 17:80971915-80971937 AACCCAGGGCTGGCAGGAGCTGG + Intergenic
1153491730 18:5656204-5656226 AAGGCAGGACTGGCTTAACCTGG - Intergenic
1153860600 18:9200820-9200842 AACCCTGTACTGCCTATACCTGG - Intronic
1157305879 18:46517225-46517247 AACCCAGGACTGTCTAAATTGGG + Intronic
1157816673 18:50734544-50734566 AACCCAGGCCTGGCTGCAGCAGG - Intergenic
1157846922 18:51012687-51012709 AACCAAGGATTGGCCAGTCCTGG - Intronic
1157996144 18:52558690-52558712 AATCCAGGACTGAGGAGACCCGG - Intronic
1160065421 18:75569716-75569738 AACCCAGAACAGGATGGACCTGG - Intergenic
1160939471 19:1613644-1613666 AACCCGGGACTGGGGAGTCCAGG + Intronic
1161723353 19:5915453-5915475 GCTGCAGGACTGGCTAGACCAGG + Exonic
1162572278 19:11480482-11480504 AACCCGGGCCTAGCTAGGCCTGG + Intronic
1163673167 19:18640949-18640971 AACTAAGGACTGGCCATACCAGG - Intronic
1163729096 19:18939711-18939733 CACCCATGACTGGCCAGAGCGGG + Intronic
1164145777 19:22511653-22511675 GACCCAGGACTGGCAGGAGCAGG + Intronic
1164897544 19:31890400-31890422 AACTGAGGACTGGCTAAAACAGG - Intergenic
1167340642 19:48913819-48913841 AAACCAGGCTTGGCTAGGCCTGG + Intronic
1167526499 19:49987529-49987551 AAACCAGCACTGGTAAGACCTGG + Intronic
925294904 2:2769832-2769854 AACCCTGGGCCGGCGAGACCTGG + Intergenic
928319278 2:30270250-30270272 AAACCAGGGCTGGCTTGCCCTGG + Intronic
929531803 2:42757307-42757329 AACCCAGCACTGGCCACAGCAGG - Intergenic
934710486 2:96511071-96511093 AAGCCAGCACTGCCTAGCCCAGG + Intergenic
946168543 2:217879876-217879898 CACCCAGGACTGGCTTCAGCTGG + Intronic
947717437 2:232349028-232349050 AGCCCAGGCCTGGCTGGCCCAGG + Intergenic
948928703 2:241116492-241116514 AACCAAGGACTGGAAAGCCCTGG + Intronic
1171034781 20:21706084-21706106 GACCCAGGACTGGGTCGCCCAGG - Intronic
1172617776 20:36300470-36300492 TACCCAGGAGGGGCTGGACCTGG + Intergenic
1173982102 20:47232479-47232501 AACCCAGGAGTGGCCAGCCTGGG + Intronic
1176172632 20:63702934-63702956 AGCCCAGGACTGACCAGCCCAGG - Intronic
1178325847 21:31644932-31644954 AACCTATTACTGGCAAGACCAGG - Intergenic
1179402580 21:41097650-41097672 AACCAAGGCCTGGCTACACAGGG + Intergenic
1179885700 21:44313400-44313422 AGCCCAGGCCTGGCCAGCCCAGG - Intronic
1180193549 21:46180878-46180900 AACCCAGGTCTTGCTGGACACGG - Intronic
1183826472 22:40391877-40391899 AACCCAGCTCTGGCTGGGCCTGG + Intronic
1185098244 22:48823137-48823159 ACCCCAGGACTGGTAAGGCCTGG + Intronic
1185306679 22:50121493-50121515 AACCCAGCACTGCCCAGGCCGGG - Intronic
950142882 3:10627470-10627492 AACCCAGGACTGGCTAACCCAGG - Intronic
950737875 3:15025286-15025308 ACTCCAGAACTGGCTAGAACTGG + Intronic
951469123 3:23036322-23036344 AAGCCAGGACAGGCTGTACCTGG - Intergenic
951679035 3:25275169-25275191 AACCCAAGTCTGGCTAGGCGCGG + Intronic
954448789 3:50560699-50560721 ATCCCAGGACTGCCTTGGCCTGG + Intronic
958788003 3:98620115-98620137 AAAGGAGGACTGGTTAGACCTGG + Intergenic
960818980 3:121706920-121706942 AACCCATGACTGGCCAGGCACGG + Intronic
961617679 3:128195941-128195963 AACCGTGGCCTGGCTAGACTTGG + Intronic
962278204 3:134031054-134031076 AGCCCAGGCCAGGCCAGACCAGG - Intronic
962494153 3:135922728-135922750 AACTCAGCACTGGCGAAACCGGG - Intergenic
963224067 3:142842977-142842999 AACCCCCAACTGGCCAGACCGGG - Exonic
963897567 3:150703421-150703443 CACCCAGGAGTGGGTGGACCAGG + Intronic
969558969 4:7933661-7933683 AGCTCAGGACTAGCTAGGCCAGG - Intronic
969928051 4:10603725-10603747 CACCCAGGAGTGCATAGACCTGG - Intronic
975771903 4:77734182-77734204 AATGCAGGACTGACAAGACCTGG - Intronic
981694075 4:147541969-147541991 AACCCAGGACTCTCTAGATTTGG - Intronic
984849740 4:184143453-184143475 GGCACAGGACTGGCTAGTCCAGG - Intronic
985623308 5:967907-967929 AAGCCAAGACTGCCTAAACCAGG + Intergenic
986717528 5:10534635-10534657 AACCCAGGCCTCGCTAACCCCGG - Intergenic
988216640 5:28283432-28283454 AATGCAGGACTGGCTACAGCTGG - Intergenic
989558228 5:42821399-42821421 ACCACAGCACTGCCTAGACCAGG + Intronic
992869652 5:80993641-80993663 TGCCCAGGGCTGGCTAGAGCAGG + Intronic
996558711 5:124805392-124805414 AACCCAAGACTGGCTAATTCCGG + Intergenic
998096082 5:139396134-139396156 GACCCAGGACAGGCTACACTGGG + Intergenic
1001415376 5:171541773-171541795 AACCGGGGCCTGGCTAGACTTGG - Intergenic
1002403793 5:179012477-179012499 TACCCAGGACTGGTTACTCCGGG + Intergenic
1006399046 6:33805349-33805371 ACCCAAGGACTGGCTAGGCAGGG - Intergenic
1007206472 6:40156251-40156273 AACCCTGGACTAGCTGGACTCGG - Intergenic
1011117449 6:83909210-83909232 ACCTCTGGAGTGGCTAGACCAGG - Intronic
1019469648 7:1211891-1211913 CAGCCAGGACTGTCCAGACCAGG + Intergenic
1020643852 7:10789711-10789733 AAACCAAGACTGGCAAGAGCAGG + Intergenic
1021889515 7:25173526-25173548 AACCCCGCACTGGCTAGGCAAGG + Intronic
1023043702 7:36193979-36194001 AACCCAGAACCGGCAAGTCCTGG - Intronic
1025199474 7:56952891-56952913 AACCCAGCAATGGGGAGACCTGG - Intergenic
1025607062 7:63047185-63047207 ACCCCAGGACTCTCTAGGCCTGG + Intergenic
1025672472 7:63624039-63624061 AACCCAGCAATGGGGAGACCTGG + Intergenic
1026822027 7:73556464-73556486 AACCCAGGTCTGGCTAGGTGAGG - Intronic
1027257327 7:76439413-76439435 AGCCCAGGACTGGCCAGGCACGG + Intronic
1027281520 7:76612628-76612650 AGCCCAGGACTGGCCAGGCACGG - Intronic
1029174670 7:98656101-98656123 AACCCAGGAGTGTCCAGGCCTGG - Intergenic
1029381741 7:100219709-100219731 AACCCAGCCCTGGCTAGGCCTGG - Exonic
1034286582 7:149887666-149887688 AGCCCAGGATTGGCTCGACTTGG - Intergenic
1038362677 8:26898219-26898241 AAGCCAGCACTGGGTAAACCTGG - Intergenic
1040595713 8:48835558-48835580 ATCCCAGGCTTGGCCAGACCCGG - Intergenic
1047304907 8:123644784-123644806 TTGCCAGGACTGGCTAGTCCTGG - Intergenic
1047805383 8:128354138-128354160 AACCAAGGACTAGAGAGACCTGG + Intergenic
1049572389 8:143375363-143375385 AACACAGGCCTGGCCAGAGCAGG - Intronic
1049985385 9:946251-946273 ACCCCAAGACTGGCTGCACCTGG + Intronic
1052851299 9:33380128-33380150 AACCTAAGACTAGCCAGACCAGG + Intergenic
1057088505 9:92234488-92234510 GACCCAGGAATGGCCAGTCCTGG + Intronic
1057110873 9:92469666-92469688 AAGCCAGGCCTGGCTATTCCAGG - Intronic
1061242244 9:129381513-129381535 AACCCAGGCCTGGCTGCAGCAGG - Intergenic
1061365147 9:130168787-130168809 GACACAGAACTGGCTAGACTCGG - Intergenic
1061614794 9:131772736-131772758 CGCCCAGCACTGGCTGGACCAGG + Intergenic
1187518897 X:19996317-19996339 AACCCAGGACTGGCAGAACCAGG + Intergenic
1190736151 X:53256886-53256908 AAACCAGGGCAGGCAAGACCCGG - Intronic
1192180366 X:68912288-68912310 AGGCCAGGCCGGGCTAGACCGGG + Intergenic
1192259105 X:69493378-69493400 AACCCAGGAACGCCTAGTCCAGG - Intergenic
1195197476 X:102513521-102513543 AAGTCAGGACTCACTAGACCTGG + Intergenic
1198541160 X:137641263-137641285 ACCCCAGGACTGGCTCCACAGGG - Intergenic