ID: 922943906

View in Genome Browser
Species Human (GRCh38)
Location 1:229493769-229493791
Sequence ATGCTTAGGAATTGCTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922943906 Original CRISPR ATGCTTAGGAATTGCTATGC AGG (reversed) Intronic
903404278 1:23083338-23083360 ATGCTTGGGGACTGCTGTGCAGG - Exonic
907938390 1:59063557-59063579 ATGCATAGCAATTGCTCAGCTGG + Intergenic
911667006 1:100564821-100564843 CTGCTTAGAAATTTCTTTGCCGG - Intergenic
911977746 1:104522587-104522609 ATGTTTAGATAATGCTATGCTGG + Intergenic
917162060 1:172068577-172068599 TTCCTAAGGAATTGCTCTGCTGG + Intronic
921893236 1:220373286-220373308 AAGATTAGGAGTTGCTATCCAGG - Intergenic
922440240 1:225650036-225650058 GTGCTTAGGAAGTGCTTTTCAGG - Intronic
922943906 1:229493769-229493791 ATGCTTAGGAATTGCTATGCAGG - Intronic
1071846488 10:89526287-89526309 ATTCTGGGGAATAGCTATGCTGG - Intronic
1072062698 10:91831305-91831327 ATGCTTAAGAATTGTCCTGCAGG + Intronic
1080696480 11:34607072-34607094 ATTATTAGGAACTGCTTTGCTGG + Intergenic
1088481926 11:110302630-110302652 ATGCTTAAGAAATGCTCGGCTGG + Intergenic
1089251567 11:117166567-117166589 ATGTTTTTGAATTGCTTTGCTGG + Intronic
1094261424 12:28504455-28504477 TAGCTTAGAAATTACTATGCTGG - Intronic
1098704267 12:73666654-73666676 ATCCTTATGAAATGCTATACAGG - Intergenic
1106916664 13:34522679-34522701 ATACTTAAAAATTGCTATGAGGG + Intergenic
1107713604 13:43175143-43175165 ATACTTAGGAATGGAAATGCTGG + Intergenic
1110686357 13:78379701-78379723 ATGTTTAAGCATTGCTAGGCTGG + Intergenic
1113325729 13:109279348-109279370 ACACTTGGGAATTGCTTTGCAGG + Intergenic
1119812035 14:77529877-77529899 CTGCTTAGAAATTGCTTTACTGG - Intronic
1121113735 14:91329644-91329666 CTGCTTAGCAACTGCCATGCTGG + Intronic
1121590517 14:95103228-95103250 ATGCTCAGAAATTGCTACACCGG - Intronic
1121737083 14:96226034-96226056 TTCCTTAGGAATTGCTTTTCTGG + Intronic
1122280426 14:100619110-100619132 TTGATTAGGAAGTGCTATCCCGG + Intergenic
1133435404 16:5775238-5775260 AAGCTTAGGAACAGCTATGGTGG - Intergenic
1135612902 16:23884026-23884048 ATGTTGAAGACTTGCTATGCGGG - Intronic
1135656321 16:24253526-24253548 ATTCTTTGGAATTGCTGTCCAGG - Intergenic
1148966859 17:51443016-51443038 ATTCTAAGGAAATGCAATGCAGG - Intergenic
1156656481 18:39294505-39294527 ATACTTAGGAAGTGGTGTGCAGG + Intergenic
1159969143 18:74627629-74627651 ATCCTTAGGAAATGCTCTTCTGG - Intronic
1165705537 19:37973690-37973712 ATGCTTAGGAAGTGGAATGCTGG + Intronic
925417081 2:3677838-3677860 ATGCTCAGAAATCGTTATGCTGG - Intronic
926654487 2:15386233-15386255 ACGCTTAGGAATTTCTAGGAAGG + Intronic
929788525 2:45008383-45008405 ATGCTTAGGCCTTTCTATGCCGG - Intronic
932794209 2:74680800-74680822 ATGCTTAGGAATATTTATGAGGG + Exonic
933132090 2:78684152-78684174 TTGCTTAGTCTTTGCTATGCGGG - Intergenic
933229901 2:79794599-79794621 ACGCTTAAGACTTGCTAAGCGGG - Intronic
939654081 2:144801124-144801146 ATGTTTTGGGATTGCTATGAAGG + Intergenic
941711711 2:168721466-168721488 ATGCTTAGGAATGGAATTGCTGG + Intronic
947120822 2:226812888-226812910 TTGCTTAGGAATTTCTAGGTAGG + Intergenic
1169891272 20:10454762-10454784 ATCCTTAGGAATGGAAATGCTGG + Intronic
1174512511 20:51064911-51064933 TTGTTTAGCAATTGATATGCAGG + Intergenic
1183796332 22:40121493-40121515 CTGCTTAGGAAAAGCTGTGCCGG + Intronic
954015636 3:47687840-47687862 GAGGTTAGGAATTACTATGCTGG - Intronic
960107128 3:113809891-113809913 TTGCAAAGGAATTGCTTTGCAGG + Exonic
962566030 3:136661102-136661124 ATACCTAGGCATTGCTATGGTGG - Intronic
962991510 3:140581467-140581489 AAGCTTAGGACTTGCTAAGGTGG + Intergenic
967327143 3:188252482-188252504 ATTCTTAGAAATGGGTATGCTGG + Intronic
970115190 4:12686864-12686886 ATGTTTAGCAATTGCTCTACGGG + Intergenic
972877831 4:43386559-43386581 GTGCTTAGTAATTGCTTTGGTGG + Intergenic
977068853 4:92356827-92356849 ATGCTTAAAAATTGATGTGCAGG + Intronic
977324897 4:95562804-95562826 AAGATTAGTAATTGCTATGTGGG + Intergenic
980029240 4:127807274-127807296 AGGAATAGGAATTGCTATGTAGG + Intronic
981947791 4:150369450-150369472 ATGCTTAGAAATTGCTGTGGTGG + Intronic
989741391 5:44777166-44777188 CTGCTTAGGTATTGCTAAGAGGG - Intergenic
995116276 5:108483275-108483297 ATGCTTCAGAATTGTTTTGCAGG - Intergenic
998772211 5:145558890-145558912 ATTCTTAGGAGTTGGTTTGCTGG - Intronic
999889630 5:155963139-155963161 AAGCTTAGGAACTGCTTTGGTGG - Intronic
999994633 5:157080540-157080562 ATGCTTGGGAACTGCTGTGCAGG + Intergenic
1000019171 5:157303967-157303989 ATGGTTAGAAAGTGCTATCCTGG - Intronic
1003292426 6:4791144-4791166 ATTCTTAGGAATGTCAATGCTGG - Intronic
1003746288 6:9006062-9006084 ATGATTAGGAAGTGCAATGAAGG + Intergenic
1005080841 6:21954715-21954737 ATACTTAGCAATTACAATGCTGG + Intergenic
1010951354 6:82040649-82040671 AAACTTAGGAATTTCTATGCTGG - Intergenic
1013189646 6:107791308-107791330 ATGCTAAGAAATTGGTCTGCAGG + Intronic
1015312679 6:131782588-131782610 ATGCTAATGCATTGCTAGGCTGG + Intergenic
1015502762 6:133951512-133951534 ATGCTGAGTACTTGCTGTGCTGG - Intergenic
1021528315 7:21614071-21614093 ATGCTTTGGAATTGCGAGGCTGG - Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1027166469 7:75838042-75838064 TTGCTTAAGAATTGCTGGGCAGG + Intergenic
1036439516 8:8767933-8767955 TTGCTTAAGAATTTCTATCCTGG - Intergenic
1039285231 8:36032728-36032750 TTGCTTAGTATTGGCTATGCAGG - Intergenic
1040899127 8:52400076-52400098 ATACTTAGGTATTCCAATGCTGG + Intronic
1046172495 8:110529075-110529097 AAACTTAGGAAATGCTATTCTGG - Intergenic
1047035011 8:120928024-120928046 ATGCAGAGAACTTGCTATGCTGG + Intergenic
1050084113 9:1946572-1946594 ATGTTTGGGAATTGATTTGCGGG - Intergenic
1051360173 9:16275324-16275346 ATGTTTAGGAGTTGGTATGTTGG - Intronic
1051462209 9:17333841-17333863 ATGCTCAGTAATTGCTATTGAGG - Intronic
1052078791 9:24177783-24177805 ATGCTTAGGATTGGCTATTCTGG + Intergenic
1052303579 9:26980503-26980525 GTGCTTTGGATTTGCTATTCTGG + Intronic
1052697823 9:31900877-31900899 ATGCTGAGGCATTGATATGAGGG + Intergenic
1187520146 X:20005835-20005857 ATGCTGAGGAATGGGTATGGAGG + Intergenic
1192131486 X:68555693-68555715 ATAATTAGGAATTCCTATTCTGG - Intergenic
1192698396 X:73442967-73442989 ATGCTTAGCAATTGGAATGAAGG - Intergenic
1197120703 X:122888371-122888393 ATTCCTAGGAATTGCACTGCGGG - Intergenic
1198997521 X:142590922-142590944 ATGGTTATGAATGGCTATGAAGG + Intergenic
1200810124 Y:7475632-7475654 TTGCTTAGGATTGGCTATGTGGG + Intergenic