ID: 922945259

View in Genome Browser
Species Human (GRCh38)
Location 1:229508472-229508494
Sequence CACTGCAGCGGTTCTAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922945259_922945261 -10 Left 922945259 1:229508472-229508494 CCAGATCTAGAACCGCTGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 211
Right 922945261 1:229508485-229508507 CGCTGCAGTGCCGAGCTTCCAGG 0: 1
1: 0
2: 1
3: 7
4: 152
922945259_922945264 3 Left 922945259 1:229508472-229508494 CCAGATCTAGAACCGCTGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 211
Right 922945264 1:229508498-229508520 AGCTTCCAGGGACGTGAAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 172
922945259_922945266 12 Left 922945259 1:229508472-229508494 CCAGATCTAGAACCGCTGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 211
Right 922945266 1:229508507-229508529 GGACGTGAAGCCGGAAAGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 131
922945259_922945262 -9 Left 922945259 1:229508472-229508494 CCAGATCTAGAACCGCTGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 211
Right 922945262 1:229508486-229508508 GCTGCAGTGCCGAGCTTCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922945259 Original CRISPR CACTGCAGCGGTTCTAGATC TGG (reversed) Intergenic