ID: 922946158

View in Genome Browser
Species Human (GRCh38)
Location 1:229515904-229515926
Sequence ACATACAGACAAGCCTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922946153_922946158 0 Left 922946153 1:229515881-229515903 CCCAGGGTCAGGGGAGACCTTGA 0: 1
1: 0
2: 1
3: 15
4: 211
Right 922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG 0: 1
1: 0
2: 2
3: 19
4: 236
922946151_922946158 9 Left 922946151 1:229515872-229515894 CCTGTCAGGCCCAGGGTCAGGGG 0: 1
1: 0
2: 1
3: 34
4: 349
Right 922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG 0: 1
1: 0
2: 2
3: 19
4: 236
922946154_922946158 -1 Left 922946154 1:229515882-229515904 CCAGGGTCAGGGGAGACCTTGAA 0: 1
1: 0
2: 2
3: 24
4: 189
Right 922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG 0: 1
1: 0
2: 2
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922946158 Original CRISPR ACATACAGACAAGCCTGGGA CGG Intergenic
902805199 1:18857003-18857025 ACCTTCAGACAGTCCTGGGATGG + Intronic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
903507866 1:23851424-23851446 ACATACAAATAATCCTGGGAAGG + Intronic
903783108 1:25835300-25835322 ACATACAGGGAATCCTGGAATGG - Exonic
903815780 1:26063445-26063467 GCAAAAAGACAAGCCTGGAAAGG - Intronic
904855704 1:33496831-33496853 ACATACAGAAAGCCCTGGGCAGG - Intergenic
904921648 1:34012915-34012937 AAATGCAGACAAGCCTGGAGAGG - Intronic
905812958 1:40926405-40926427 ACAAACAAACAAACCTGGGAGGG - Intergenic
906652092 1:47520135-47520157 ACAGACAGGCCAGCCAGGGATGG - Intergenic
906911993 1:49963037-49963059 TCATCCAGAGAAGCCTGTGATGG - Intronic
908846538 1:68329986-68330008 ACCTCCAGACAAGCCAAGGATGG - Intergenic
910017881 1:82549925-82549947 ACACAGAGACAAGTCTGGGCTGG - Intergenic
910434851 1:87195762-87195784 ACAGACAGACAAGTCTGGGGAGG + Intergenic
911096858 1:94062034-94062056 ACAGATATACAGGCCTGGGATGG + Intronic
912604857 1:110979686-110979708 ACATACATACAAGTATGGTATGG - Intergenic
914825211 1:151134534-151134556 ACAAAAGGCCAAGCCTGGGATGG + Intronic
915326445 1:155083365-155083387 ACGGACAGGCAAGCCTAGGATGG + Intronic
916576783 1:166074128-166074150 CCATATAGAAAAGCCTTGGAAGG - Intronic
919251307 1:195059816-195059838 ACATAAAGGCAAGACAGGGAAGG + Intergenic
919763555 1:201112659-201112681 ACTTACACACAGGCCTGGGATGG + Intergenic
919898184 1:202022931-202022953 ATATACAAACATGCCTGGGGTGG + Intergenic
920533701 1:206723557-206723579 ACATGAAGACAAGACTGGGAAGG - Intronic
921215358 1:212932387-212932409 ACCTACAAAGAAGACTGGGAAGG - Intergenic
922502163 1:226105182-226105204 ACCAGCAGAAAAGCCTGGGATGG - Intergenic
922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG + Intergenic
923008447 1:230069985-230070007 ACACAATGACAAGCCTGGGCTGG - Intronic
1062770112 10:92464-92486 ACACACATCCAAGCCTGTGAGGG + Intergenic
1064595968 10:16945610-16945632 ATATAAAAACTAGCCTGGGATGG + Intronic
1066576745 10:36834167-36834189 ACATACAGACAGGCCGGGCGCGG + Intergenic
1068578535 10:58711907-58711929 ACAGAAAGACAAGCCAGAGACGG + Intronic
1068831022 10:61494974-61494996 ACTGACAGATAAGCCTGTGAAGG - Intergenic
1069464442 10:68625925-68625947 AAATACAAAAAAGCCTGGCATGG + Intronic
1069560206 10:69423764-69423786 AAACACAGCCAAGCCTGGGATGG - Intergenic
1069614779 10:69800203-69800225 CCATTCAGACTAGCCTGGGAGGG + Intergenic
1070227912 10:74530766-74530788 AAATACAAAAAAGCCTGGCAGGG + Intronic
1070647412 10:78211341-78211363 ACAGATAGAAAAGACTGGGAGGG - Intergenic
1071561608 10:86650220-86650242 GCCTACCCACAAGCCTGGGAAGG - Intergenic
1073017461 10:100412811-100412833 AAATACAAACAAACCTGGCATGG - Intergenic
1074697768 10:116066120-116066142 ACAAACAAACAAGCCCAGGAAGG - Intronic
1075199167 10:120387833-120387855 ACATACAGTGAGGTCTGGGAGGG - Intergenic
1076206829 10:128610478-128610500 ATATTCAGACAAGCCCAGGAAGG + Intergenic
1079233674 11:18671710-18671732 ACATACAGATCAGCCAGGCATGG + Intergenic
1079260278 11:18871935-18871957 ACATGAAGACATGGCTGGGAAGG - Intergenic
1080553315 11:33393226-33393248 TCATGCAGACAAGGCTGGGAAGG - Intergenic
1081320783 11:41689467-41689489 TCATACAGCCAAGTCTGGCATGG - Intergenic
1083450404 11:62740674-62740696 ACATACATACTAGCCGGGTACGG + Intergenic
1087141077 11:94767035-94767057 ACAGAAGGAAAAGCCTGGGAGGG - Intronic
1088338725 11:108738899-108738921 ACATGGAGACAGGCCTGGGTTGG + Intronic
1088635969 11:111820938-111820960 ACACACACACAAGCCAGGTATGG + Intronic
1090250572 11:125248010-125248032 AGACACAGACATACCTGGGATGG - Intronic
1091348059 11:134868537-134868559 ACCCACACACAGGCCTGGGAAGG - Intergenic
1091561097 12:1614184-1614206 AAATACACACATGCCTAGGAGGG + Intronic
1091737462 12:2934644-2934666 AAATAGAAACAAGCTTGGGAGGG - Intronic
1092279886 12:7090966-7090988 AGAGAAAGACAGGCCTGGGAAGG + Intronic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1094601761 12:31915205-31915227 CCATTCAGACAAGACTGGGCAGG - Intergenic
1094602708 12:31923863-31923885 CCATACAGACAAGCTGGGCAGGG - Intergenic
1094603311 12:31929508-31929530 ACATACAGCCAGGCCTGGTTCGG - Intergenic
1095943086 12:47739039-47739061 ACACACAGATAGGCATGGGATGG + Intronic
1097677367 12:62617158-62617180 ACATAGAGAGAGGCCTGGGGTGG - Intergenic
1102152283 12:110697090-110697112 TCAAGCAGAGAAGCCTGGGAGGG + Intronic
1103082848 12:118039137-118039159 ACATCCTGGCAAGGCTGGGAGGG - Intronic
1103140451 12:118543531-118543553 ACAAACAGTCAAGACTGGGCAGG + Intergenic
1104219584 12:126769031-126769053 ATATACAAATAAGCCTGGCATGG - Intergenic
1104877715 12:132047787-132047809 TCATCCTGATAAGCCTGGGAGGG + Intronic
1109280458 13:60349650-60349672 ACAGACAGACAGACCTGGGACGG + Intergenic
1110768441 13:79307034-79307056 ACATGCAGAAATGCCTTGGAGGG - Intergenic
1114617634 14:24076658-24076680 TGATAAAGACAGGCCTGGGATGG - Intronic
1115460695 14:33657299-33657321 ACATACAGAAAAGCCTTCTAAGG + Intronic
1119984615 14:79123251-79123273 ACACACACACAAGCCTGGGAAGG + Intronic
1120818988 14:88894611-88894633 ACATACAGACACACAGGGGAGGG - Intergenic
1121729475 14:96176293-96176315 ACAGACAGCCAAGTTTGGGATGG + Intergenic
1121835528 14:97088768-97088790 GCATTGAGACAAGCATGGGACGG - Intergenic
1121984912 14:98495917-98495939 ACATTCAGAGAAGCCGGAGATGG + Intergenic
1122245182 14:100397611-100397633 GCATAAAGAACAGCCTGGGAGGG + Intronic
1122623971 14:103074979-103075001 GCACACAGACAGGCCTGGCAGGG - Intergenic
1122629358 14:103100231-103100253 ACAGACAGACACTCCTGGGCCGG + Exonic
1123800135 15:23810691-23810713 GCATAGAGATAAGTCTGGGAGGG + Intergenic
1125152240 15:36546153-36546175 ACTTTCAGAAAAGCCTGGGTTGG + Intergenic
1125368255 15:38942240-38942262 GCAGATAGAGAAGCCTGGGAGGG - Intergenic
1128162888 15:65435979-65436001 AAGTACAGACTAGCATGGGATGG - Intergenic
1128933667 15:71727612-71727634 ACACACACACAAGCCAGGCATGG + Intronic
1131204469 15:90430233-90430255 AGATTCAGACAGGACTGGGATGG - Intronic
1133673668 16:8048781-8048803 ACATACAGAGAGGCCGGGCAAGG + Intergenic
1134220080 16:12346866-12346888 ATACACAGGCAAGCCAGGGAGGG - Intronic
1134745148 16:16582012-16582034 ACAGACCGAGCAGCCTGGGAAGG + Intergenic
1134907244 16:17990672-17990694 ACTTATATCCAAGCCTGGGAAGG + Intergenic
1135204825 16:20474619-20474641 GCATAAAGAAAAGCATGGGATGG + Intronic
1135214072 16:20549194-20549216 GCATAAAGAAAAGCATGGGATGG - Intronic
1135476963 16:22785280-22785302 AGATAGAGAAAACCCTGGGAAGG + Intergenic
1137313286 16:47287691-47287713 AAAAACAGACAACCCTGGTATGG - Intronic
1137381344 16:48002523-48002545 ACAAACAGACAAGCCTTGCTGGG - Intergenic
1137391154 16:48082444-48082466 ACATGCACACACACCTGGGAGGG + Intergenic
1137937409 16:52647651-52647673 AGATTGAGACAAGCCTTGGAGGG + Intergenic
1138027775 16:53536134-53536156 ACACACACACACGCCAGGGATGG + Intergenic
1139278018 16:65746020-65746042 ACCTTCAGACATCCCTGGGATGG + Intergenic
1140284243 16:73586096-73586118 ACATACACAAAAGCCAGGCATGG + Intergenic
1141504021 16:84462921-84462943 ACCTCCAGGCAAGACTGGGATGG + Intronic
1142367715 16:89658778-89658800 AGCTACAGTCCAGCCTGGGACGG - Intronic
1143868950 17:9944234-9944256 ACTTTTAGACATGCCTGGGATGG - Intronic
1144953224 17:19004872-19004894 ACAGACAGACAGACCTGGGGCGG + Intronic
1145786261 17:27595741-27595763 ACCACCAGACAGGCCTGGGAAGG - Intronic
1145823152 17:27855846-27855868 ACAAACAAAAAAGCCTGGCATGG + Intronic
1148249917 17:46068271-46068293 ATATACACACAGGCCGGGGATGG + Intronic
1150937581 17:69653680-69653702 ACTGAAAGACAAGCCTGGAATGG - Intergenic
1155474887 18:26227290-26227312 ACCGACAGACAAGGCTGGAAAGG - Intronic
1155503456 18:26510069-26510091 ACAGACAGACAAGCCTTCTATGG + Intronic
1155904314 18:31430409-31430431 ACATAAAGTCATGCCAGGGAAGG + Intergenic
1157491075 18:48124242-48124264 ACCCTCAGGCAAGCCTGGGATGG + Intronic
1158215750 18:55098925-55098947 ACATACAGACAACACTGTGCTGG + Intergenic
1159867724 18:73725976-73725998 AGATACAAAAAAGCCTTGGAAGG + Intergenic
1160438857 18:78873487-78873509 ACAAACAAACAAGCCGGGCATGG - Intergenic
1160664055 19:314759-314781 ACATACAGCCTAGCATGTGAAGG + Intronic
1161761506 19:6176383-6176405 ACTGACAGACAAGCATGAGATGG - Intronic
1161761616 19:6177267-6177289 ACTGACAGACAAGCATGAGACGG + Exonic
1166419419 19:42625040-42625062 ACACACAGAGATGCATGGGAGGG - Intronic
1168201178 19:54817094-54817116 GCAGACATACAAGCCTGGAAAGG + Intronic
926772992 2:16394432-16394454 ACACAGAGAGAAGCCTGGGGAGG - Intergenic
926975745 2:18515163-18515185 AGACACAGTGAAGCCTGGGAAGG - Intergenic
929533294 2:42765258-42765280 ATATGCAGACAGGCCTGGGTTGG + Intergenic
930227014 2:48804507-48804529 AGATTCTGAGAAGCCTGGGAAGG + Intergenic
930380264 2:50619033-50619055 ACATAAAGAGAAGACAGGGAAGG + Intronic
931436286 2:62250167-62250189 ACAAACAAACAGGCCTGGGGAGG + Intergenic
932711646 2:74069732-74069754 ACATACCAACAAGCCTGGCTAGG + Intronic
933469228 2:82699883-82699905 TCATACATACAAGTCAGGGAAGG + Intergenic
933675636 2:85054405-85054427 ATATACTGACAAATCTGGGAAGG - Exonic
936547973 2:113409229-113409251 ACATGCAAAGAAGCATGGGAAGG - Intergenic
942003387 2:171673437-171673459 AGTTCCAGACCAGCCTGGGATGG - Intergenic
942963521 2:181861597-181861619 AGGTAGAGACAAGGCTGGGAGGG - Intergenic
946228257 2:218276404-218276426 TCCTACAGCCCAGCCTGGGAGGG + Intronic
947567867 2:231206564-231206586 ACATAGAAAAAAGTCTGGGAGGG - Intronic
948280589 2:236744766-236744788 ACATTCACACAAGCCTGGGGTGG + Intergenic
948403215 2:237699701-237699723 GCATTCAGACACGCCTGCGATGG - Intronic
1168949937 20:1790585-1790607 ACGTGCAGACTAGCATGGGAGGG + Intergenic
1171363030 20:24603577-24603599 ACATGGACACACGCCTGGGATGG + Intronic
1172086423 20:32387329-32387351 ACAAATAGAAAAGCCTGGGCTGG - Intronic
1172210879 20:33197699-33197721 AGAGACAGACAGACCTGGGATGG - Intergenic
1172342624 20:34170338-34170360 AGATACAGAGAAGACTGGGAAGG - Intergenic
1173262871 20:41452036-41452058 ACATACAGACAGGTGTTGGAGGG + Intronic
1174116573 20:48230554-48230576 ACATCCAGACAAGCCTGGCAGGG - Intergenic
1174572385 20:51511250-51511272 ACAAACAGACAAGCCCAGGAGGG - Intronic
1175028392 20:55927796-55927818 ACAAACAAACAACCCTGGAAGGG + Intergenic
1176302025 21:5102976-5102998 AGAGACAGACAGGCCTGGGTAGG + Intergenic
1177319401 21:19500765-19500787 GCATACAGACATCTCTGGGAAGG - Intergenic
1178605799 21:34035683-34035705 ACATCCAGCCAGGCCTGGCATGG - Intergenic
1178675051 21:34623730-34623752 ACCTGCAGACAGGCCTGGGGTGG - Intergenic
1179855004 21:44158924-44158946 AGAGACAGACAGGCCTGGGTAGG - Intergenic
1180788478 22:18560012-18560034 ACACACAGTCAAGTCTGAGAAGG + Intergenic
1181233259 22:21435306-21435328 ACACACAGTCAAGTCTGAGAAGG - Intronic
1181245391 22:21499537-21499559 ACACACAGTCAAGTCTGAGAAGG + Intergenic
1183524448 22:38315282-38315304 ACAACCAGGCCAGCCTGGGAGGG + Intronic
1184683433 22:46085235-46085257 ACAAACAGACCTGCCCGGGAAGG - Intronic
949251047 3:1984224-1984246 ACGTGCATACATGCCTGGGAAGG + Intergenic
950129818 3:10534290-10534312 GCATTCAGACCAGCCTGGGTGGG + Intronic
950673891 3:14543157-14543179 AGATACAGCCAGGCCTGGGGTGG + Intergenic
951900344 3:27651599-27651621 ACAGTCAGCCAAGGCTGGGAAGG - Intergenic
952407232 3:33015478-33015500 CCCTACATACAAGCCAGGGAAGG - Intronic
954429621 3:50463596-50463618 ACAGACAGCCCTGCCTGGGAAGG + Intronic
956634760 3:71352886-71352908 ACATACAGATAAACCTAAGAAGG + Intronic
959138422 3:102454436-102454458 ACATCCAGACAAGAAAGGGAAGG - Intronic
959476764 3:106821579-106821601 AGACACTGACAAGCATGGGAGGG + Intergenic
960789125 3:121407473-121407495 ACATAAAGGCAAGTCTGAGAAGG - Exonic
962209186 3:133462528-133462550 CCATACGGAAAAGCCAGGGAAGG - Intronic
962385301 3:134927953-134927975 ACAGACAAGCAGGCCTGGGATGG - Intronic
967861266 3:194153576-194153598 ACTCACAGATAAGACTGGGAGGG + Intergenic
969901550 4:10354915-10354937 ACAGACACAGAAGCCTGGGAAGG - Intergenic
971191353 4:24431829-24431851 ACATAAAATCAAGCCAGGGAAGG + Intergenic
971526544 4:27625903-27625925 ACATACATACAGGCCTGGCGCGG - Intergenic
971551541 4:27964257-27964279 ACAGACAGACAAGACAGGGAAGG - Intergenic
973644769 4:52939396-52939418 AGATTCAGACAAGCCTGGATTGG - Intronic
974091173 4:57313110-57313132 ACCTAAAGACAAGTCTGGGTTGG + Intergenic
977417725 4:96755906-96755928 AAATACAGACAAGCTTAGGGAGG + Intergenic
977475565 4:97503574-97503596 ACATACATACTAGCCAGGCACGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
981888809 4:149712602-149712624 AAATACAAACAAGACTGGTAAGG + Intergenic
983178565 4:164620767-164620789 ACATACAGAGAAGATTGGCATGG + Intergenic
983761542 4:171413694-171413716 ACAAACAAACAAGCCTGGCATGG + Intergenic
984776936 4:183490077-183490099 ACATACACACAGGCCGGGCATGG + Intergenic
985958827 5:3284210-3284232 ACCTTCAGGCAAGCCTGGGCTGG - Intergenic
991005544 5:61824625-61824647 CAAGAGAGACAAGCCTGGGAAGG + Intergenic
994124305 5:96152381-96152403 AAACCCAGAGAAGCCTGGGAAGG - Intergenic
994571348 5:101517917-101517939 ACAAACAAACACGCCTGGGCAGG + Intergenic
995239208 5:109866595-109866617 ACATACAGACTACGCTTGGAAGG - Intronic
996785443 5:127231879-127231901 ACAGACTGAGAAGCGTGGGAAGG + Intergenic
996797021 5:127358552-127358574 AAAAACAGAAGAGCCTGGGATGG + Intronic
996982344 5:129514032-129514054 ACAAAAAGACAAACATGGGATGG - Intronic
997245259 5:132342762-132342784 ACATACAGAGAGGTCTGGAAGGG + Intronic
997311179 5:132884528-132884550 AAATACAAACAAGCCGGGCATGG - Intronic
997359897 5:133288398-133288420 AGACCCAGACAGGCCTGGGAGGG - Intronic
997596797 5:135112544-135112566 AAATGCAGGCAGGCCTGGGATGG - Intronic
998104442 5:139459460-139459482 ACATACAAAAAAGCCAGTGAGGG - Intronic
999368737 5:151039927-151039949 ACAGCCAGCCAAGACTGGGATGG + Intronic
1000418188 5:161006139-161006161 AGAGACAAAGAAGCCTGGGATGG - Intergenic
1001343503 5:170868560-170868582 ACAAACAGACAGGCCAGGCATGG - Intronic
1002885574 6:1290607-1290629 TCCTACAGCCAGGCCTGGGATGG + Intergenic
1005355126 6:24975420-24975442 AAATTCAGAAAAGCATGGGATGG + Intronic
1007375464 6:41453205-41453227 ACAGTCAGAGAAGCCTGGGGAGG - Intergenic
1007776611 6:44227554-44227576 AAACACAGACAGGCCAGGGAAGG - Intronic
1011535302 6:88370143-88370165 ACATACAGAGGAGACTGAGAAGG + Intergenic
1011671929 6:89691991-89692013 ACATACAAGCAAGCCTGGAATGG + Intronic
1012367648 6:98461842-98461864 ACAGACAAAGAAGCCTGGAAAGG + Intergenic
1012661297 6:101897421-101897443 ACAGACAGACCAGCCTGGAGAGG - Intronic
1012958928 6:105601762-105601784 AAGTACAGACAAGCCTGCCAAGG + Intergenic
1013533387 6:111040781-111040803 GCATGCAGACAAGCCGGGCATGG + Intergenic
1015321747 6:131883254-131883276 TCATACAGAGAAGCCTTGTATGG + Intronic
1015716038 6:136192873-136192895 ACATACAGATGAACATGGGAAGG - Exonic
1015937514 6:138417990-138418012 GCTTAAAGACAAGCCTTGGAAGG + Exonic
1016934551 6:149440012-149440034 ACCTACACACAAACCTGTGAAGG - Intergenic
1016975795 6:149806341-149806363 ATGTAGAGACTAGCCTGGGAAGG + Intronic
1017228917 6:152051525-152051547 ACATACAGAGAAGCAGGGGGAGG - Intronic
1017865906 6:158442971-158442993 ACAAACAAACAAGCCGAGGATGG - Intronic
1018425371 6:163675198-163675220 TATTACAGAGAAGCCTGGGATGG + Intergenic
1019501050 7:1364948-1364970 CCATGCAGCCCAGCCTGGGAAGG - Intergenic
1019860278 7:3652368-3652390 ATGCACAGACAAGCCTGGGAAGG + Intronic
1024392280 7:48828739-48828761 GAATACAGACAAGCCTGGGCAGG + Intergenic
1027264675 7:76487812-76487834 ACAGACAGGAAAGCCAGGGAGGG + Intronic
1027316047 7:76985914-76985936 ACAGACAGGAAAGCCAGGGAGGG + Intergenic
1028463151 7:91118934-91118956 ACGTAGTGACCAGCCTGGGATGG + Intronic
1029243156 7:99178933-99178955 AAATACAAAAAAGCCTGGCATGG - Intronic
1032076534 7:128838707-128838729 ACATACAGACCTGCCATGGAGGG + Exonic
1035181561 7:157093084-157093106 ACAGAGAGAGAAGCCTGGCATGG + Intergenic
1037510972 8:19582277-19582299 ACCAACAGACAAACCTGGTAAGG + Intronic
1040866741 8:52055285-52055307 TCATATTCACAAGCCTGGGAGGG - Intergenic
1040929305 8:52717212-52717234 ACAAACAAACAAGCATGGTAGGG - Intronic
1041430409 8:57775800-57775822 ATATATAGGCAAGCCTGAGAAGG - Intergenic
1041498881 8:58518112-58518134 ACATACAGGGCAACCTGGGAAGG - Intergenic
1041522688 8:58772699-58772721 ACATAAACAAAAGCATGGGAAGG - Intergenic
1041640017 8:60188178-60188200 ACATACACACACACCTGTGAAGG + Exonic
1043073636 8:75668295-75668317 ACATAAAGGCAAGCCTGAGGTGG - Intergenic
1043320108 8:78973970-78973992 ACATACAGACAATTCTTTGAAGG + Intergenic
1044833082 8:96269134-96269156 ACAAACAGACAAGCTTAGGGAGG - Intronic
1047375203 8:124289235-124289257 AGATATAGACAACCCAGGGAAGG + Intergenic
1047985155 8:130225611-130225633 ACACACAGACAACACTTGGATGG + Intronic
1049364649 8:142231296-142231318 ACACACTGTGAAGCCTGGGAAGG - Intronic
1050932952 9:11353160-11353182 ACATATTCATAAGCCTGGGATGG + Intergenic
1051083801 9:13323522-13323544 AGAACCAGACAAGCCTGGGCTGG - Intergenic
1051398796 9:16657108-16657130 CCCTACAGAGAAGCCTGGGTTGG + Intronic
1053796211 9:41729106-41729128 ACATAAGGATAAACCTGGGATGG + Intergenic
1054184616 9:61941176-61941198 ACATAAGGATAAACCTGGGATGG + Intergenic
1054653891 9:67647321-67647343 ACATAAGGATAAACCTGGGATGG - Intergenic
1054823030 9:69543150-69543172 ACAGACTGGCAGGCCTGGGAGGG + Intronic
1055084083 9:72296244-72296266 ACATTCAGCCAAGGGTGGGAGGG + Intergenic
1056645236 9:88405986-88406008 ACAGACACACAAGCCAGGCACGG - Intronic
1059675759 9:116537539-116537561 ACATACAGTGAAGCCCTGGAAGG + Intronic
1060550338 9:124482000-124482022 AGATAAATACCAGCCTGGGAGGG + Exonic
1060999643 9:127895997-127896019 ACAGACCGTCAGGCCTGGGAAGG + Intronic
1187128523 X:16477682-16477704 AGAGCCAGACAATCCTGGGATGG - Intergenic
1187310208 X:18134563-18134585 CCATACAGCCAAGCCTCAGATGG + Intergenic
1187796973 X:23014510-23014532 AAAAACAGAAATGCCTGGGAAGG - Intergenic
1189311703 X:40023595-40023617 ACATACAGATTAGCCAGGTATGG + Intergenic
1191209568 X:57871207-57871229 ACATACAGGCAAGTTTGGGCTGG - Intergenic
1193595775 X:83443176-83443198 ACATGCAGACAAATGTGGGAGGG + Intergenic
1193976419 X:88125217-88125239 CCATACAGACAAGTTTGGCATGG + Intergenic
1195158364 X:102145016-102145038 ACAGACCGAGAAGCCTGAGAAGG - Intergenic
1195464758 X:105168157-105168179 ATAGCCAGACAGGCCTGGGATGG + Intronic
1195688728 X:107606926-107606948 ACTCACACACAAGTCTGGGATGG - Intergenic
1197196462 X:123707176-123707198 ACATACAGAAAAAACTGGAAAGG - Intronic
1198121390 X:133595808-133595830 ACATAAAGACAAGAGTGGTAGGG - Intronic