ID: 922950901

View in Genome Browser
Species Human (GRCh38)
Location 1:229558215-229558237
Sequence CGCCTCCCGGGGACAAGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922950901_922950921 28 Left 922950901 1:229558215-229558237 CCGCCCCTTGTCCCCGGGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 922950921 1:229558266-229558288 CCCTGCCCAGGCAGCGGCTGCGG 0: 1
1: 0
2: 5
3: 71
4: 505
922950901_922950916 16 Left 922950901 1:229558215-229558237 CCGCCCCTTGTCCCCGGGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 922950916 1:229558254-229558276 CCAGGCCTCGTCCCCTGCCCAGG 0: 1
1: 1
2: 11
3: 70
4: 664
922950901_922950909 -2 Left 922950901 1:229558215-229558237 CCGCCCCTTGTCCCCGGGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 922950909 1:229558236-229558258 CGCCGCCGGCCCGCGCCGCCAGG 0: 1
1: 2
2: 7
3: 80
4: 532
922950901_922950923 29 Left 922950901 1:229558215-229558237 CCGCCCCTTGTCCCCGGGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 922950923 1:229558267-229558289 CCTGCCCAGGCAGCGGCTGCGGG 0: 1
1: 0
2: 6
3: 57
4: 489
922950901_922950918 22 Left 922950901 1:229558215-229558237 CCGCCCCTTGTCCCCGGGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 922950918 1:229558260-229558282 CTCGTCCCCTGCCCAGGCAGCGG 0: 1
1: 1
2: 4
3: 31
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922950901 Original CRISPR CGCCTCCCGGGGACAAGGGG CGG (reversed) Exonic