ID: 922953357

View in Genome Browser
Species Human (GRCh38)
Location 1:229578077-229578099
Sequence TTGAGTCCCCACTATGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922953356_922953357 -10 Left 922953356 1:229578064-229578086 CCATTCAATGATGTTGAGTCCCC No data
Right 922953357 1:229578077-229578099 TTGAGTCCCCACTATGAGCAAGG No data
922953355_922953357 7 Left 922953355 1:229578047-229578069 CCTACTAGCAAACATTTCCATTC No data
Right 922953357 1:229578077-229578099 TTGAGTCCCCACTATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922953357 Original CRISPR TTGAGTCCCCACTATGAGCA AGG Intergenic
No off target data available for this crispr