ID: 922958999 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:229628985-229629007 |
| Sequence | GCCTCCCCTTTGTTTCACCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 172 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 10, 4: 158} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 922958999_922959000 | -7 | Left | 922958999 | 1:229628985-229629007 | CCAGGGTGAAACAAAGGGGAGGC | 0: 1 1: 0 2: 3 3: 10 4: 158 |
||
| Right | 922959000 | 1:229629001-229629023 | GGGAGGCTCTAGCAGCCAATTGG | 0: 1 1: 0 2: 0 3: 3 4: 109 |
||||
| 922958999_922959001 | 0 | Left | 922958999 | 1:229628985-229629007 | CCAGGGTGAAACAAAGGGGAGGC | 0: 1 1: 0 2: 3 3: 10 4: 158 |
||
| Right | 922959001 | 1:229629008-229629030 | TCTAGCAGCCAATTGGATCAAGG | 0: 1 1: 0 2: 1 3: 4 4: 122 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 922958999 | Original CRISPR | GCCTCCCCTTTGTTTCACCC TGG (reversed) | Intronic | ||