ID: 922958999

View in Genome Browser
Species Human (GRCh38)
Location 1:229628985-229629007
Sequence GCCTCCCCTTTGTTTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922958999_922959000 -7 Left 922958999 1:229628985-229629007 CCAGGGTGAAACAAAGGGGAGGC 0: 1
1: 0
2: 3
3: 10
4: 158
Right 922959000 1:229629001-229629023 GGGAGGCTCTAGCAGCCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 109
922958999_922959001 0 Left 922958999 1:229628985-229629007 CCAGGGTGAAACAAAGGGGAGGC 0: 1
1: 0
2: 3
3: 10
4: 158
Right 922959001 1:229629008-229629030 TCTAGCAGCCAATTGGATCAAGG 0: 1
1: 0
2: 1
3: 4
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922958999 Original CRISPR GCCTCCCCTTTGTTTCACCC TGG (reversed) Intronic