ID: 922958999

View in Genome Browser
Species Human (GRCh38)
Location 1:229628985-229629007
Sequence GCCTCCCCTTTGTTTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922958999_922959000 -7 Left 922958999 1:229628985-229629007 CCAGGGTGAAACAAAGGGGAGGC 0: 1
1: 0
2: 3
3: 10
4: 158
Right 922959000 1:229629001-229629023 GGGAGGCTCTAGCAGCCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 109
922958999_922959001 0 Left 922958999 1:229628985-229629007 CCAGGGTGAAACAAAGGGGAGGC 0: 1
1: 0
2: 3
3: 10
4: 158
Right 922959001 1:229629008-229629030 TCTAGCAGCCAATTGGATCAAGG 0: 1
1: 0
2: 1
3: 4
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922958999 Original CRISPR GCCTCCCCTTTGTTTCACCC TGG (reversed) Intronic
900474019 1:2868001-2868023 GCCTCCTCTTTCTCACACCCTGG + Intergenic
901273305 1:7970601-7970623 CCCTCCCATTTCTTTCTCCCTGG + Intronic
904265033 1:29313244-29313266 GCCTGCCCTCTGTCTCCCCCTGG + Intronic
906243705 1:44258409-44258431 GCCTTCACTTTCTTTCCCCCTGG + Intronic
907419437 1:54336924-54336946 ACCTCCCCTCTGTCACACCCTGG - Intronic
908826213 1:68135164-68135186 GCCTCCTCTATCTATCACCCAGG + Intronic
910265428 1:85332658-85332680 CCCTCCCCATTGGTTGACCCAGG + Intronic
910649343 1:89548633-89548655 CCCTCAGTTTTGTTTCACCCTGG + Intronic
911493547 1:98600362-98600384 GGCTCCCTTTTCTTTCACACAGG - Intergenic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
916740096 1:167640033-167640055 GTCTCCCATTTGTTTCCCCAAGG - Intronic
917586208 1:176429390-176429412 GACTCCTCTGTTTTTCACCCTGG + Intergenic
920149491 1:203893055-203893077 GACTCCCCTGTGTTCCACCCAGG - Intergenic
920380617 1:205532587-205532609 GGCTCCCCTCTGTATCCCCCAGG + Intronic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
923474552 1:234320739-234320761 GACTGCCCTTTGTTTTCCCCTGG + Intronic
1064398754 10:15002935-15002957 GCCTCCCCTGTGTACCACGCAGG - Intergenic
1065875440 10:29993617-29993639 TTCTCTCCTTTGTTTCATCCTGG - Intergenic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1069790839 10:71019630-71019652 GCCTCCGCTGTGATTCACCTAGG + Intergenic
1072009776 10:91292625-91292647 GCTTCCCCTCTTCTTCACCCTGG + Intergenic
1073486297 10:103820883-103820905 GGCTTCCCTGTGTTTCTCCCCGG - Intronic
1075114748 10:119616772-119616794 GACTCCCCTTAGTGTCACCACGG - Intergenic
1076221106 10:128733820-128733842 GCCTCCCCATTGTTAGGCCCAGG + Intergenic
1076280932 10:129245053-129245075 TCTTCCCCAGTGTTTCACCCAGG + Intergenic
1076618918 10:131774661-131774683 GCCTCCCATGTGTCTGACCCCGG - Intergenic
1077726974 11:4684510-4684532 GCCTGCTCTTTTCTTCACCCTGG - Intronic
1077896014 11:6454077-6454099 GCCTCCCCATTGTTTCAGAGTGG - Intronic
1080836124 11:35942917-35942939 CCTTCCCCTTTCTTTCAGCCAGG + Intergenic
1081240514 11:40700056-40700078 CCCTCCCCTTAACTTCACCCGGG - Intronic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1084468721 11:69342782-69342804 GCCTGCCCCTTGTTTCTCCAGGG - Intronic
1087237975 11:95741511-95741533 GCCTTCCCTTTTCTTCATCCTGG + Intergenic
1094740906 12:33287416-33287438 GCCTCTACTTTGTCTTACCCTGG + Intergenic
1100243113 12:92729527-92729549 GCCTCCCCATGGTACCACCCTGG - Intronic
1101264123 12:103066050-103066072 GCCTCCGCTGTGATTCACCTAGG - Intergenic
1102245906 12:111355625-111355647 GCCTCCCCTCTGTCCCTCCCTGG - Intergenic
1105586327 13:21747766-21747788 CATTCCCCTTTGTTGCACCCAGG + Intergenic
1105860263 13:24403899-24403921 GCCTCTCCTTTGTGGCATCCCGG + Intergenic
1107434832 13:40372981-40373003 GCATCCCCTGTGTCTCCCCCGGG - Intergenic
1108146570 13:47483654-47483676 CCCTCCCTTTTCTTTCACCTTGG - Intergenic
1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG + Intronic
1113587864 13:111477404-111477426 TCCTGCCCTTTGGCTCACCCTGG - Intergenic
1114266341 14:21074670-21074692 GCCTCCCCTGAGTCTCCCCCAGG + Exonic
1115022904 14:28704568-28704590 GACTCCCCTTTAATTGACCCTGG - Intergenic
1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG + Intronic
1115944482 14:38644142-38644164 ACCCACCCTTTGTATCACCCTGG + Intergenic
1118607504 14:67514763-67514785 GACACCCCTTTGTTTCAGGCAGG + Intronic
1119298666 14:73553167-73553189 GCCTCCCCTTCTTCTCCCCCAGG + Intronic
1119302955 14:73585345-73585367 GCCTCCCCTTCTTCTCCCCCAGG + Intergenic
1121006638 14:90494944-90494966 GCCTACCCTTTGATTAAGCCAGG - Intergenic
1121544349 14:94752410-94752432 GCCTCCCCGGTGTTCCACCATGG + Intergenic
1128870592 15:71152627-71152649 TCCTCTCCTCTGCTTCACCCTGG - Intronic
1129764839 15:78157385-78157407 GCCTCCCCTTTGATGACCCCCGG + Intronic
1130041205 15:80406177-80406199 ACCTCCCCTTTGTCTCTCCTTGG - Intronic
1131889456 15:96956676-96956698 GTCTGGCCTTTCTTTCACCCTGG + Intergenic
1133627073 16:7580585-7580607 GCCTGCTCTGTGTTTCACCATGG - Intronic
1140423261 16:74838752-74838774 GCCTCCAGTTTGTTGAACCCAGG + Intergenic
1142559800 17:803189-803211 GCTCCCCGTCTGTTTCACCCAGG - Intronic
1142896560 17:2982998-2983020 TCCTCCCCTGTGACTCACCCAGG + Intronic
1146448169 17:32949887-32949909 GCCACAACTTTGCTTCACCCTGG + Intergenic
1151222305 17:72622267-72622289 GTCTACCCTTTGTTTCAGGCTGG - Intergenic
1152543615 17:80989679-80989701 GCCAACCCTTTGTTTCACCCTGG - Intergenic
1152581399 17:81166887-81166909 CCTTCCCCTATGTTTCTCCCAGG + Intergenic
1152908779 17:82985015-82985037 GCCTCCCCTTTGGGCCTCCCTGG + Intronic
1157706584 18:49813032-49813054 GCCTCTCCATCGATTCACCCGGG + Intronic
1158675281 18:59512787-59512809 GCCTGCTCTTTGTCTTACCCGGG - Intronic
1160135091 18:76264868-76264890 TCCTCACCTTTGTTTCTCCTGGG - Intergenic
1161196838 19:2991611-2991633 GCCTCCCCTTGGCCTCACCTAGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161633530 19:5371815-5371837 GCCTCCCGTTTGCTGCACACGGG + Intergenic
1163261129 19:16190707-16190729 GGCTCCCCTTTGAATAACCCTGG - Intronic
1163315312 19:16537129-16537151 ACCTCCCCTTTATCTCAGCCTGG + Intronic
1163953618 19:20613744-20613766 GCTTCCCCTTGATGTCACCCTGG - Intronic
1164080602 19:21858708-21858730 GCCTCTCCTCTGTTTCTACCAGG - Intergenic
1164246948 19:23438993-23439015 CTCTCCCCTTTGTCACACCCAGG + Intergenic
1165014989 19:32874322-32874344 GCCTACCCTGTGCTTCACTCAGG - Intergenic
1165431410 19:35775565-35775587 CCCTCCCCTTTGTGTCGCCATGG + Exonic
1165862004 19:38914217-38914239 CCCTCCCCTTTGGTTAACCCTGG - Intergenic
1167035598 19:46993473-46993495 GCCGCCACTTTGTTTGACCTTGG + Intronic
1168051221 19:53831289-53831311 GCCTGCCCTTTTTTTTGCCCAGG - Intergenic
1168336462 19:55600190-55600212 GAGTCCCCTTTGTTTCCCGCGGG + Intronic
927472451 2:23385987-23386009 TCCCCCCCTTTTTTTCCCCCTGG - Intronic
930273713 2:49286296-49286318 TTCCCCCGTTTGTTTCACCCTGG - Intergenic
933194416 2:79372100-79372122 GCCTCACCTCAGGTTCACCCCGG - Intronic
934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG + Exonic
936013879 2:108943302-108943324 GCCTCCCCTCTGTTTCTCCCAGG - Intronic
946415734 2:219538844-219538866 GCCTGCCTTTCCTTTCACCCGGG - Intergenic
947653457 2:231807254-231807276 CCCTTCCATTTGTTTCAACCAGG + Intronic
1169732538 20:8802034-8802056 GCCTCCCTTTTTTTCCACACAGG + Intronic
1170764486 20:19278448-19278470 GCATCCCCTCTGTTTCAGGCTGG - Intronic
1171077917 20:22148237-22148259 ACCTCCCCTTATTTTCACCTAGG + Intergenic
1171545713 20:25998930-25998952 GCCTCCCCTCCTTTTCACTCAGG + Intergenic
1172090859 20:32431498-32431520 GCCTCCCCTTTGCCTCTCTCTGG + Intronic
1173455274 20:43196627-43196649 GTCTTCTCTTTCTTTCACCCAGG + Intergenic
1174858088 20:54065736-54065758 GGCTCCCCTCTGGCTCACCCTGG + Intronic
1175086261 20:56461654-56461676 GTCTCCCCTAGATTTCACCCCGG - Intergenic
1175291557 20:57879313-57879335 CCCTCCCCTGTGTTTCTCCCAGG + Intergenic
1175485302 20:59341980-59342002 GCCCTCACTTGGTTTCACCCTGG + Intergenic
1179713997 21:43278517-43278539 GCCTCCCCTTTGGTGCTCTCAGG + Intergenic
1181260667 22:21595033-21595055 GCCTCCCTCTGGTTTCACGCTGG + Intronic
1182711069 22:32323688-32323710 GCCTCTGCTTGGTTTCCCCCAGG + Intergenic
1182776483 22:32834945-32834967 GCCTCCCCTTCTCTTCAGCCAGG + Intronic
953450231 3:42999427-42999449 GCCTCCCTGCTGTTTCTCCCAGG + Intronic
954149016 3:48648000-48648022 GCCTCCCCTTTCTTTCTCCTGGG - Intronic
954401980 3:50323746-50323768 GCCTAGCCTTTGTTTCCCCGGGG - Intronic
954778555 3:53042533-53042555 GTCTCCCTTTTCTTTCATCCAGG + Intronic
960090265 3:113631399-113631421 GCTTCTCCTTAGTTTCACCAGGG - Intergenic
967193107 3:187002128-187002150 GCCTCCCATTTGTTTCAAGATGG - Intronic
968530891 4:1091007-1091029 GCCTCCCCTGTGTTTGCCCTTGG - Intronic
969847438 4:9930345-9930367 TCCTACCCTCTTTTTCACCCTGG - Intronic
970449804 4:16155699-16155721 GCTTCCCTCTTGTTTCCCCCGGG + Intergenic
971539623 4:27800046-27800068 GCCTCCCCTTTTCTTCACTCAGG + Intergenic
971735401 4:30443320-30443342 GCCTCCCATTTGTTTTCCCTAGG + Intergenic
978775887 4:112506520-112506542 GCCTCCCCTATGTTTCCCAGTGG - Intergenic
979669849 4:123350783-123350805 GCATCCACTTTGTGTCATCCTGG + Intergenic
982784916 4:159525507-159525529 GGTTCCCATTTGTTTCACCCAGG - Intergenic
983394334 4:167174499-167174521 GCCTCCTCCTTGTTTCAACCCGG - Intronic
986049614 5:4076650-4076672 GCCCACCCAATGTTTCACCCAGG - Intergenic
989425481 5:41291043-41291065 GCCACAACTTTGTTCCACCCAGG + Intergenic
992387484 5:76299354-76299376 GCCTTCCTTTTTTTTCCCCCTGG - Intronic
995199219 5:109409073-109409095 ACCTCCCCTTTGCTTCAACTTGG + Intronic
995256577 5:110053626-110053648 AGCTCCCCTTTTATTCACCCTGG - Intergenic
995386532 5:111595709-111595731 GCCACAACTTTGCTTCACCCCGG - Intergenic
996277978 5:121691563-121691585 TCCTGCCTTTTGTTTCAGCCAGG - Intergenic
996403075 5:123084149-123084171 GCCTCCAGTTCCTTTCACCCTGG - Intergenic
997629169 5:135353648-135353670 TCCTCCCCTGGGTTTCACCATGG - Intronic
997677042 5:135720710-135720732 TCTTCCCTTTTTTTTCACCCTGG - Intergenic
998003078 5:138639919-138639941 CCCTGCCCTTTCTGTCACCCTGG + Intronic
999570016 5:152909276-152909298 GCCTCCTCTGTGTAACACCCTGG - Intergenic
1000180095 5:158800722-158800744 GTCTCCCCTCTGTTTCTCTCTGG - Intronic
1000988635 5:167888713-167888735 GCCTTTCCTTTGATTCCCCCAGG + Intronic
1002896069 6:1381303-1381325 GCCTCCCCTTTGTATCAAGCCGG + Intergenic
1003483782 6:6556970-6556992 ACCTGCCCTTTGAATCACCCTGG + Intergenic
1005788404 6:29270943-29270965 GCCACCCCTTTCTTTCTTCCAGG - Intergenic
1006207843 6:32365254-32365276 GCCTTCCCTTTGTTTTCCCTAGG + Intronic
1011135271 6:84093333-84093355 GCTGCACCATTGTTTCACCCTGG - Intergenic
1013946590 6:115729137-115729159 GCCTCTGCTGTGTGTCACCCAGG + Intergenic
1017982663 6:159414979-159415001 GCCTCCCATTTGTTTTCCCTAGG - Intergenic
1018867795 6:167759217-167759239 GCCTCCCCTGGGTGCCACCCTGG - Intergenic
1019488959 7:1302172-1302194 GCCTCCACGTGGTTTCTCCCAGG - Intergenic
1019789435 7:3001349-3001371 GCCTCCCCTTTCTTTCCCCATGG - Intronic
1024675736 7:51636537-51636559 ACCTCCCCTTGCTCTCACCCAGG - Intergenic
1026305112 7:69133928-69133950 GTCTCACCTTTGTTTTTCCCTGG + Intergenic
1029550897 7:101236595-101236617 GCCGCCCCATTGTTTCTCCGGGG - Intronic
1032488257 7:132304813-132304835 GCAACCCCTTTGTGTCTCCCAGG + Intronic
1035082199 7:156225875-156225897 CCCTTCCCTTTTTTTAACCCTGG + Intergenic
1035162665 7:156962487-156962509 GCGTCCTCTTTGCCTCACCCCGG + Intronic
1037483464 8:19326342-19326364 GCCTCTCCTTTGGGACACCCCGG - Intronic
1037574482 8:20188304-20188326 TCCTTCCCTTTGTTTCATCTTGG + Intergenic
1038481536 8:27905169-27905191 CCCTCTCCTTTGTTTTCCCCTGG - Intronic
1041757964 8:61334672-61334694 GCCTCTCCTCTGTATCACCATGG - Intronic
1042215329 8:66425382-66425404 CCCTCCCCTCTTTTTCTCCCAGG - Intergenic
1047470322 8:125165084-125165106 GCCTCCTCCTTGTTCCTCCCTGG + Intronic
1052895882 9:33748112-33748134 GTCACACCTTTGTTTCACCATGG + Intergenic
1055966772 9:81873076-81873098 ACCTCCCCTTTCTTTCCCACTGG + Intergenic
1056567048 9:87782876-87782898 GTCTCCACTCTGTTCCACCCAGG + Intergenic
1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG + Intronic
1058707909 9:107652458-107652480 GGCTCCCCTTTGCTTCAGCTTGG + Intergenic
1058731067 9:107850472-107850494 GCCTTCCATTTGTTCCACTCAGG - Intergenic
1059253153 9:112905221-112905243 GCCTCAGATGTGTTTCACCCTGG - Intergenic
1059445134 9:114333291-114333313 GCCTGCCCTGAGTTTAACCCTGG + Intergenic
1060039021 9:120283798-120283820 GCCTCCCCTATGTGTCATTCAGG - Intergenic
1060923018 9:127435938-127435960 GCCTTCCCTTTGTTCCAACTGGG - Exonic
1061990939 9:134158401-134158423 GCCTCCCCTTTGGCCCACGCCGG + Exonic
1188013793 X:25085659-25085681 GCCTTCCATTTATTTCACTCAGG + Intergenic
1188407434 X:29828893-29828915 ACCTCCTCTTTTTTTCCCCCCGG - Intronic
1188916737 X:35920282-35920304 GCCTCCCCATTTCTTCAACCTGG + Intronic
1190740884 X:53288097-53288119 GCCTCCCATTTGGCTCAGCCCGG - Intronic
1193297771 X:79852597-79852619 GCCTCCACTGTGATTCACCTAGG - Intergenic
1194436509 X:93874073-93874095 TCCTCCCATTTGTGTGACCCAGG + Intergenic
1197824818 X:130577706-130577728 GCCTCACTTTTTTTTCACTCTGG - Intergenic