ID: 922959280

View in Genome Browser
Species Human (GRCh38)
Location 1:229632154-229632176
Sequence CAATTGCCACGGGGGCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922959280 Original CRISPR CAATTGCCACGGGGGCGGCG GGG (reversed) Intronic
900405292 1:2490301-2490323 CACTGGCCACGGGGGTGGCTGGG - Intronic
906627132 1:47334239-47334261 CCACTGCCACGCGGGCGGCGCGG - Intronic
906640827 1:47439386-47439408 CATGGGCCACGGTGGCGGCGGGG + Exonic
909008220 1:70302291-70302313 CAACTCACACAGGGGCGGCGGGG + Intronic
916051377 1:161039009-161039031 CAGGTGCTGCGGGGGCGGCGCGG - Intergenic
920541839 1:206784654-206784676 GCATGGCCCCGGGGGCGGCGGGG + Intergenic
922959280 1:229632154-229632176 CAATTGCCACGGGGGCGGCGGGG - Intronic
1064381809 10:14849579-14849601 AAATTGACACGGGGGCGGGGTGG + Intronic
1067236963 10:44459176-44459198 GCAGGGCCACGGGGGCGGCGGGG - Intergenic
1067294718 10:44968739-44968761 CAAATGCCACGGGGGGCGGGGGG - Intronic
1067970458 10:50964252-50964274 CAATTGCCACTGAGGCTGGGTGG - Intergenic
1068791227 10:61033668-61033690 CAATTGTTACTGGGGCGGGGGGG + Intergenic
1071038486 10:81277349-81277371 CAAATGTCTCTGGGGCGGCGGGG + Intergenic
1076818412 10:132925928-132925950 CAAGTGCCACAGGGTCGGCTGGG - Intronic
1080431074 11:32200517-32200539 CAATTGATACGGTGGCGGCACGG + Intergenic
1093183169 12:15989237-15989259 CAGTTGCAGCGGGGGAGGCGTGG - Intronic
1094165060 12:27435288-27435310 CAATTGCCGGGGGGGGGGGGGGG - Intergenic
1103562679 12:121800520-121800542 CGAGGGCCACGGGGTCGGCGGGG - Intronic
1104676512 12:130715300-130715322 CACTGGCCCCGGGGGAGGCGGGG - Intronic
1107412702 13:40172480-40172502 CCACTGCCACGGGGGCAGCCTGG + Intergenic
1115338185 14:32263192-32263214 CAGTTGCCAAGGGGGTGGAGTGG - Intergenic
1122624869 14:103079395-103079417 CAAGTGGCAAGGGGGCGGGGTGG + Intergenic
1122900558 14:104780607-104780629 CTATGGCCACAGGGGCTGCGGGG + Intronic
1132536694 16:485130-485152 CAGTTGCCACGGGGGCTGCGTGG - Intronic
1134090517 16:11389162-11389184 CAAGAGCCACGGGGCCAGCGTGG - Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1143021158 17:3917843-3917865 CAATGGCCACAGGGGCAGCTGGG - Intergenic
1145935173 17:28711098-28711120 CAATTACCTCCGCGGCGGCGAGG - Intronic
1148235358 17:45964968-45964990 CAACTGCCAGGGGGGCAGCTGGG - Intronic
1151364868 17:73610594-73610616 CAGTAGCCACGAGGGAGGCGGGG + Intronic
1153457063 18:5294574-5294596 CAATGGCAAGGGGGGCGGGGCGG - Intronic
1161154686 19:2726579-2726601 CAGTTCCCACGGGGGGGGGGGGG + Intronic
1161769109 19:6221881-6221903 CAAATGCCACCGAGGAGGCGAGG + Intronic
1161962499 19:7530266-7530288 GAACTGCCAGAGGGGCGGCGGGG - Exonic
1165528770 19:36379116-36379138 CAATGGGCGCGGGGGTGGCGCGG - Intronic
1166564335 19:43754568-43754590 CAATGGCCAAGGCGGGGGCGGGG + Intronic
927558004 2:24049671-24049693 CCACTGGCAAGGGGGCGGCGGGG - Intronic
931714868 2:65021089-65021111 CACTGGCCACGGGGCCAGCGGGG - Exonic
932621898 2:73269633-73269655 CGCGTGCCGCGGGGGCGGCGGGG - Exonic
935754745 2:106268212-106268234 CACTTGCCCCCGGGGCGGCCTGG - Intergenic
1173528363 20:43749962-43749984 CACTTCCCACGCGGGCGGCTGGG + Intergenic
1179784056 21:43719693-43719715 CAACTGCCGCGGGGGCGGGCGGG + Intronic
1179911820 21:44454978-44455000 CACTGGCCACGGGGTAGGCGAGG + Intergenic
1184642864 22:45881431-45881453 CAGCTGCCACGGGGGCGCTGGGG - Intergenic
952451758 3:33440036-33440058 CAATTGCAGCGGGAGCGGCCGGG + Exonic
954133725 3:48572583-48572605 CAAATGCCATGGGGGTGGCAGGG - Intronic
960223977 3:115147955-115147977 CAATTGCCGAGAGGGCTGCGGGG + Intergenic
969179112 4:5423890-5423912 CAACTCACAAGGGGGCGGCGGGG - Intronic
975701899 4:77075371-77075393 GCGCTGCCACGGGGGCGGCGCGG + Intronic
999905902 5:156141213-156141235 GAATTGCCACAGGGGCGGGAAGG + Intronic
1007462070 6:42026276-42026298 CCCTTGGCAGGGGGGCGGCGGGG - Intronic
1008085684 6:47241953-47241975 CAATTGCCAAGTGGACAGCGAGG + Intronic
1017954814 6:159169279-159169301 CAGGGGCGACGGGGGCGGCGGGG - Intergenic
1027160798 7:75800711-75800733 AAAATGACACGGGGGAGGCGGGG + Intergenic
1044529778 8:93293870-93293892 CAAATCCCACGGGGGCTGAGTGG - Intergenic
1049183923 8:141238805-141238827 CAGCTGCCAGGGGGCCGGCGCGG + Intronic
1049776693 8:144409276-144409298 CAACTGCCAGGTGGGCGGCCGGG - Exonic
1059530181 9:115028352-115028374 CAATTGCCACCGGGTGGGCAAGG - Intronic
1060829403 9:126704308-126704330 CATTTGCCCCCGGGGCTGCGAGG - Intergenic
1062689117 9:137832399-137832421 CAGTGGCCACGTGGGAGGCGGGG - Intronic
1191634631 X:63362660-63362682 GAATTGCCACAGGGGAGGGGAGG + Intergenic