ID: 922964413

View in Genome Browser
Species Human (GRCh38)
Location 1:229676118-229676140
Sequence CCCTGGCACCTATAACAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922964413_922964417 3 Left 922964413 1:229676118-229676140 CCATACTGTTATAGGTGCCAGGG No data
Right 922964417 1:229676144-229676166 TAGTAGTGAAGCAAATAGACAGG No data
922964413_922964418 16 Left 922964413 1:229676118-229676140 CCATACTGTTATAGGTGCCAGGG No data
Right 922964418 1:229676157-229676179 AATAGACAGGTCTGCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922964413 Original CRISPR CCCTGGCACCTATAACAGTA TGG (reversed) Intergenic
No off target data available for this crispr