ID: 922965989

View in Genome Browser
Species Human (GRCh38)
Location 1:229691242-229691264
Sequence GTGGCTTAACATCCTATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922965988_922965989 -10 Left 922965988 1:229691229-229691251 CCACGCTAAGGGGGTGGCTTAAC No data
Right 922965989 1:229691242-229691264 GTGGCTTAACATCCTATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922965989 Original CRISPR GTGGCTTAACATCCTATTGT AGG Intergenic