ID: 922967121

View in Genome Browser
Species Human (GRCh38)
Location 1:229699605-229699627
Sequence ATCCTTGCTTTGCTACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922967116_922967121 10 Left 922967116 1:229699572-229699594 CCCTCAAAGGAGGGAAGGCTTTA No data
Right 922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG No data
922967117_922967121 9 Left 922967117 1:229699573-229699595 CCTCAAAGGAGGGAAGGCTTTAA No data
Right 922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922967121 Original CRISPR ATCCTTGCTTTGCTACTTAC TGG Intergenic
No off target data available for this crispr