ID: 922969924

View in Genome Browser
Species Human (GRCh38)
Location 1:229727714-229727736
Sequence CATCGCCCGGACCCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922969924_922969942 29 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969942 1:229727766-229727788 ACGGAGGAGGGGAAAGGGGTTGG No data
922969924_922969943 30 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969943 1:229727767-229727789 CGGAGGAGGGGAAAGGGGTTGGG No data
922969924_922969931 13 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969931 1:229727750-229727772 AACCCCAGGTGACCAGACGGAGG No data
922969924_922969941 25 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969941 1:229727762-229727784 CCAGACGGAGGAGGGGAAAGGGG No data
922969924_922969936 17 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG No data
922969924_922969934 16 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969934 1:229727753-229727775 CCCAGGTGACCAGACGGAGGAGG No data
922969924_922969930 10 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969930 1:229727747-229727769 TGAAACCCCAGGTGACCAGACGG No data
922969924_922969939 24 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969939 1:229727761-229727783 ACCAGACGGAGGAGGGGAAAGGG No data
922969924_922969938 23 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969938 1:229727760-229727782 GACCAGACGGAGGAGGGGAAAGG No data
922969924_922969937 18 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969937 1:229727755-229727777 CAGGTGACCAGACGGAGGAGGGG No data
922969924_922969929 -1 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969929 1:229727736-229727758 GGCACTCAGGATGAAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922969924 Original CRISPR CATCGCCCGGACCCCTCCAA GGG (reversed) Intergenic
No off target data available for this crispr