ID: 922969928

View in Genome Browser
Species Human (GRCh38)
Location 1:229727727-229727749
Sequence TCATCCTGAGTGCCATCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922969928_922969934 3 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969934 1:229727753-229727775 CCCAGGTGACCAGACGGAGGAGG No data
922969928_922969941 12 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969941 1:229727762-229727784 CCAGACGGAGGAGGGGAAAGGGG No data
922969928_922969943 17 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969943 1:229727767-229727789 CGGAGGAGGGGAAAGGGGTTGGG No data
922969928_922969937 5 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969937 1:229727755-229727777 CAGGTGACCAGACGGAGGAGGGG No data
922969928_922969938 10 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969938 1:229727760-229727782 GACCAGACGGAGGAGGGGAAAGG No data
922969928_922969944 25 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969944 1:229727775-229727797 GGGAAAGGGGTTGGGAACAGAGG No data
922969928_922969936 4 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG No data
922969928_922969942 16 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969942 1:229727766-229727788 ACGGAGGAGGGGAAAGGGGTTGG No data
922969928_922969939 11 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969939 1:229727761-229727783 ACCAGACGGAGGAGGGGAAAGGG No data
922969928_922969930 -3 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969930 1:229727747-229727769 TGAAACCCCAGGTGACCAGACGG No data
922969928_922969931 0 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969931 1:229727750-229727772 AACCCCAGGTGACCAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922969928 Original CRISPR TCATCCTGAGTGCCATCGCC CGG (reversed) Intergenic
No off target data available for this crispr