ID: 922969936

View in Genome Browser
Species Human (GRCh38)
Location 1:229727754-229727776
Sequence CCAGGTGACCAGACGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922969924_922969936 17 Left 922969924 1:229727714-229727736 CCCTTGGAGGGGTCCGGGCGATG No data
Right 922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG No data
922969925_922969936 16 Left 922969925 1:229727715-229727737 CCTTGGAGGGGTCCGGGCGATGG No data
Right 922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG No data
922969928_922969936 4 Left 922969928 1:229727727-229727749 CCGGGCGATGGCACTCAGGATGA No data
Right 922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922969936 Original CRISPR CCAGGTGACCAGACGGAGGA GGG Intergenic
No off target data available for this crispr