ID: 922970440

View in Genome Browser
Species Human (GRCh38)
Location 1:229731900-229731922
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922970440_922970444 16 Left 922970440 1:229731900-229731922 CCTCCCAAATTCTGCTTCTCCAT No data
Right 922970444 1:229731939-229731961 CTGACAAAATTTACCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922970440 Original CRISPR ATGGAGAAGCAGAATTTGGG AGG (reversed) Intergenic
No off target data available for this crispr