ID: 922981186

View in Genome Browser
Species Human (GRCh38)
Location 1:229828305-229828327
Sequence GTTCAGGTAGCACAGTCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922981186_922981190 11 Left 922981186 1:229828305-229828327 CCCTATGACTGTGCTACCTGAAC No data
Right 922981190 1:229828339-229828361 TCACCCCTTGGCTAGATCTCTGG No data
922981186_922981191 12 Left 922981186 1:229828305-229828327 CCCTATGACTGTGCTACCTGAAC No data
Right 922981191 1:229828340-229828362 CACCCCTTGGCTAGATCTCTGGG No data
922981186_922981189 -1 Left 922981186 1:229828305-229828327 CCCTATGACTGTGCTACCTGAAC No data
Right 922981189 1:229828327-229828349 CAGATCAACTTCTCACCCCTTGG No data
922981186_922981194 15 Left 922981186 1:229828305-229828327 CCCTATGACTGTGCTACCTGAAC No data
Right 922981194 1:229828343-229828365 CCCTTGGCTAGATCTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922981186 Original CRISPR GTTCAGGTAGCACAGTCATA GGG (reversed) Intergenic