ID: 922983027

View in Genome Browser
Species Human (GRCh38)
Location 1:229844574-229844596
Sequence TTCTAGGAAGATGTCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922983027_922983031 -1 Left 922983027 1:229844574-229844596 CCATCCAGGACATCTTCCTAGAA No data
Right 922983031 1:229844596-229844618 ACAGGATATCCTGCAAAGCTTGG No data
922983027_922983036 26 Left 922983027 1:229844574-229844596 CCATCCAGGACATCTTCCTAGAA No data
Right 922983036 1:229844623-229844645 AGCAAACCATGTTGCCCCTGGGG No data
922983027_922983032 0 Left 922983027 1:229844574-229844596 CCATCCAGGACATCTTCCTAGAA No data
Right 922983032 1:229844597-229844619 CAGGATATCCTGCAAAGCTTGGG No data
922983027_922983035 25 Left 922983027 1:229844574-229844596 CCATCCAGGACATCTTCCTAGAA No data
Right 922983035 1:229844622-229844644 CAGCAAACCATGTTGCCCCTGGG No data
922983027_922983034 24 Left 922983027 1:229844574-229844596 CCATCCAGGACATCTTCCTAGAA No data
Right 922983034 1:229844621-229844643 TCAGCAAACCATGTTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922983027 Original CRISPR TTCTAGGAAGATGTCCTGGA TGG (reversed) Intergenic
No off target data available for this crispr