ID: 922983801

View in Genome Browser
Species Human (GRCh38)
Location 1:229850783-229850805
Sequence TGGGTGGAGGGGAAGCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922983792_922983801 1 Left 922983792 1:229850759-229850781 CCAAGGGGCCTGCAGCCTTGGAT No data
Right 922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG No data
922983788_922983801 17 Left 922983788 1:229850743-229850765 CCTGATTGAAGCTTCTCCAAGGG No data
Right 922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG No data
922983786_922983801 20 Left 922983786 1:229850740-229850762 CCACCTGATTGAAGCTTCTCCAA No data
Right 922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG No data
922983795_922983801 -7 Left 922983795 1:229850767-229850789 CCTGCAGCCTTGGATCTGGGTGG No data
Right 922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922983801 Original CRISPR TGGGTGGAGGGGAAGCCCTT AGG Intergenic
No off target data available for this crispr