ID: 922984301

View in Genome Browser
Species Human (GRCh38)
Location 1:229854016-229854038
Sequence CCCCAGGTCTTCCTCTTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984301_922984309 25 Left 922984301 1:229854016-229854038 CCTATTAAGAGGAAGACCTGGGG No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984301_922984308 24 Left 922984301 1:229854016-229854038 CCTATTAAGAGGAAGACCTGGGG No data
Right 922984308 1:229854063-229854085 ACACTCCCACTGCAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984301 Original CRISPR CCCCAGGTCTTCCTCTTAAT AGG (reversed) Intergenic
No off target data available for this crispr