ID: 922984303

View in Genome Browser
Species Human (GRCh38)
Location 1:229854032-229854054
Sequence AGCGTGAGGGGCGCGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984303_922984312 24 Left 922984303 1:229854032-229854054 CCTGGGGCCGCGCCCCTCACGCT No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data
922984303_922984309 9 Left 922984303 1:229854032-229854054 CCTGGGGCCGCGCCCCTCACGCT No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984303_922984313 30 Left 922984303 1:229854032-229854054 CCTGGGGCCGCGCCCCTCACGCT No data
Right 922984313 1:229854085-229854107 GGAGTATTACCCCAAGGAGCTGG No data
922984303_922984308 8 Left 922984303 1:229854032-229854054 CCTGGGGCCGCGCCCCTCACGCT No data
Right 922984308 1:229854063-229854085 ACACTCCCACTGCAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984303 Original CRISPR AGCGTGAGGGGCGCGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr